Incidental Mutation 'R4584:Cep295'
ID343927
Institutional Source Beutler Lab
Gene Symbol Cep295
Ensembl Gene ENSMUSG00000046111
Gene Namecentrosomal protein 295
SynonymsLOC382128, 5830418K08Rik
MMRRC Submission 041805-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4584 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15316915-15357788 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15334799 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 787 (L787Q)
Ref Sequence ENSEMBL: ENSMUSP00000096578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000058041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066038
Predicted Effect possibly damaging
Transcript: ENSMUST00000098979
AA Change: L787Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: L787Q

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
coiled coil region 258 288 N/A INTRINSIC
coiled coil region 536 583 N/A INTRINSIC
coiled coil region 861 889 N/A INTRINSIC
internal_repeat_1 890 1104 6.8e-5 PROSPERO
internal_repeat_1 1277 1489 6.8e-5 PROSPERO
low complexity region 1537 1548 N/A INTRINSIC
low complexity region 1611 1625 N/A INTRINSIC
coiled coil region 1707 1736 N/A INTRINSIC
low complexity region 2003 2018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160946
SMART Domains Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111

DomainStartEndE-ValueType
coiled coil region 92 119 N/A INTRINSIC
low complexity region 282 293 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
coiled coil region 451 480 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161132
AA Change: L787Q

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: L787Q

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
coiled coil region 1300 1327 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 2035 2050 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161795
AA Change: L739Q

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: L739Q

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
internal_repeat_1 842 1056 7.14e-5 PROSPERO
internal_repeat_1 1229 1441 7.14e-5 PROSPERO
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 1955 1970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162264
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (86/89)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik A G 8: 120,160,017 N343D probably damaging Het
9530002B09Rik T A 4: 122,701,186 D78E possibly damaging Het
A2m C A 6: 121,657,406 D632E probably benign Het
Alpk2 A G 18: 65,306,964 S453P probably damaging Het
Birc2 A T 9: 7,833,674 F269I probably damaging Het
Ccdc66 G A 14: 27,500,511 P92S probably benign Het
Cdc34 T A 10: 79,688,035 D108E possibly damaging Het
Cdk5rap2 A C 4: 70,266,760 V1151G probably damaging Het
Cemip T C 7: 83,958,539 K753R probably damaging Het
Cideb T C 14: 55,758,270 N8S probably benign Het
Dagla A G 19: 10,271,009 Y96H probably damaging Het
Dapl1 C A 2: 59,504,742 T80K possibly damaging Het
Ddx6 T C 9: 44,624,487 V171A probably damaging Het
Dnah12 C A 14: 26,772,594 T34K probably damaging Het
Dnhd1 T C 7: 105,678,049 L735P probably damaging Het
Ep400 T A 5: 110,733,897 probably benign Het
Erlin1 G T 19: 44,069,319 Y22* probably null Het
Gm11127 A T 17: 36,057,667 M123K probably damaging Het
Gm13212 T A 4: 145,617,177 probably null Het
Gm5771 T C 6: 41,396,767 L188P probably benign Het
Gmcl1 A G 6: 86,722,623 S141P probably damaging Het
Gtf2a1 C T 12: 91,562,926 V338I possibly damaging Het
Ighv1-66 T A 12: 115,593,396 Q22L possibly damaging Het
Igkv4-80 T C 6: 69,016,736 Y57C probably damaging Het
Itpk1 G A 12: 102,570,157 A410V possibly damaging Het
Itsn1 T A 16: 91,820,583 probably benign Het
Kcnk3 G T 5: 30,588,386 A24S probably damaging Het
Kif20a A G 18: 34,632,611 Y887C probably damaging Het
Klf13 T C 7: 63,937,970 T193A possibly damaging Het
Klhl9 G T 4: 88,721,907 H32Q probably damaging Het
Kndc1 C G 7: 139,901,243 P82A probably damaging Het
Llgl1 T A 11: 60,712,082 L861Q probably damaging Het
Lpcat2 A G 8: 92,889,371 E305G probably damaging Het
Mib2 C A 4: 155,657,287 A293S probably damaging Het
Mtfr1 A G 3: 19,215,602 E138G probably damaging Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Ninj1 T A 13: 49,193,966 probably null Het
Nlgn2 A T 11: 69,834,278 V54E possibly damaging Het
Nlrc5 A C 8: 94,477,275 I668L probably damaging Het
Npy6r T A 18: 44,276,195 C228S probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Nup107 T C 10: 117,766,368 I513M probably benign Het
Oit3 T C 10: 59,425,462 D461G probably damaging Het
Olfr324 T A 11: 58,598,004 F205I probably benign Het
Paxbp1 T C 16: 91,034,123 D455G probably damaging Het
Pcdh7 A T 5: 57,721,283 T727S probably damaging Het
Pex14 G A 4: 148,970,596 A113V probably damaging Het
Phc3 A G 3: 30,965,882 V23A possibly damaging Het
Plec T C 15: 76,231,206 D56G possibly damaging Het
Plekha7 C A 7: 116,237,533 probably benign Het
Prdm16 T C 4: 154,337,683 E885G probably damaging Het
Psd2 A G 18: 36,012,828 T762A probably benign Het
Psme4 T A 11: 30,834,318 H964Q probably damaging Het
Rbak C T 5: 143,176,123 V51I probably benign Het
Rbfa A G 18: 80,200,506 L15P probably benign Het
Ren1 T C 1: 133,354,808 Y84H probably damaging Het
Rps6ka5 A T 12: 100,581,318 I311N probably damaging Het
Samd14 T A 11: 95,021,535 probably null Het
Scaf4 T C 16: 90,229,515 probably benign Het
Serpina12 A T 12: 104,038,352 L7Q unknown Het
Serpinb9d A T 13: 33,200,616 E192V probably damaging Het
Slc22a29 A T 19: 8,169,291 F382L probably benign Het
Snta1 T A 2: 154,378,115 D375V probably benign Het
Stat5b T A 11: 100,787,238 Y683F probably damaging Het
Strip1 A T 3: 107,624,503 Y257N probably benign Het
Sugp2 A G 8: 70,251,898 H695R probably benign Het
Svep1 T A 4: 58,068,526 R3087* probably null Het
Syngr2 T C 11: 117,813,121 V138A probably damaging Het
Thra T C 11: 98,764,484 F397L probably benign Het
Tmem45b T A 9: 31,428,655 I149F probably damaging Het
Tmprss11f C T 5: 86,539,694 probably null Het
Ush2a C T 1: 188,451,798 T1433I probably benign Het
Vmn2r109 A T 17: 20,554,558 Y178* probably null Het
Vmn2r84 T G 10: 130,390,713 M419L probably benign Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp276 A G 8: 123,268,406 probably benign Het
Zfp568 T G 7: 29,998,192 F100V probably benign Het
Zfp667 T A 7: 6,290,625 D41E possibly damaging Het
Other mutations in Cep295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cep295 APN 9 15326072 splice site probably null
IGL00769:Cep295 APN 9 15326144 missense probably damaging 1.00
IGL00771:Cep295 APN 9 15322565 missense probably damaging 1.00
IGL00850:Cep295 APN 9 15322852 missense probably benign 0.36
IGL01505:Cep295 APN 9 15318049 missense probably benign 0.08
IGL01510:Cep295 APN 9 15354626 nonsense probably null
IGL01759:Cep295 APN 9 15323559 unclassified probably null
IGL02415:Cep295 APN 9 15353020 missense probably damaging 1.00
IGL02447:Cep295 APN 9 15332511 missense probably damaging 0.98
IGL02502:Cep295 APN 9 15350913 splice site probably benign
IGL02665:Cep295 APN 9 15326632 splice site probably benign
IGL02718:Cep295 APN 9 15325753 splice site probably null
IGL02995:Cep295 APN 9 15333312 missense probably damaging 1.00
IGL03024:Cep295 APN 9 15325572 missense probably benign
R0196:Cep295 UTSW 9 15338213 missense probably damaging 0.96
R0398:Cep295 UTSW 9 15354736 missense possibly damaging 0.90
R0595:Cep295 UTSW 9 15332191 nonsense probably null
R0610:Cep295 UTSW 9 15322754 missense possibly damaging 0.81
R0616:Cep295 UTSW 9 15332322 nonsense probably null
R0840:Cep295 UTSW 9 15334315 missense probably benign 0.02
R1215:Cep295 UTSW 9 15327882 missense probably benign 0.00
R1376:Cep295 UTSW 9 15340868 splice site probably benign
R1381:Cep295 UTSW 9 15322565 missense probably benign 0.02
R1484:Cep295 UTSW 9 15334784 missense probably damaging 0.99
R1557:Cep295 UTSW 9 15332010 nonsense probably null
R1655:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1682:Cep295 UTSW 9 15333921 missense probably benign 0.02
R1700:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1734:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1736:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1743:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1765:Cep295 UTSW 9 15327904 missense probably damaging 1.00
R1889:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1895:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1994:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1995:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R2071:Cep295 UTSW 9 15341564 missense probably damaging 1.00
R2161:Cep295 UTSW 9 15353058 missense probably damaging 0.99
R2195:Cep295 UTSW 9 15332321 missense probably damaging 0.99
R2354:Cep295 UTSW 9 15334784 missense possibly damaging 0.92
R2427:Cep295 UTSW 9 15334238 missense probably damaging 1.00
R2992:Cep295 UTSW 9 15332747 missense probably damaging 1.00
R3873:Cep295 UTSW 9 15333365 missense probably damaging 1.00
R3981:Cep295 UTSW 9 15317067 utr 3 prime probably benign
R4201:Cep295 UTSW 9 15332538 missense probably benign 0.19
R4297:Cep295 UTSW 9 15322654 missense probably benign 0.19
R4543:Cep295 UTSW 9 15335253 missense possibly damaging 0.94
R4724:Cep295 UTSW 9 15330832 missense probably damaging 1.00
R4878:Cep295 UTSW 9 15334956 missense probably benign 0.11
R4884:Cep295 UTSW 9 15351760 missense probably damaging 1.00
R4934:Cep295 UTSW 9 15333160 missense probably damaging 0.97
R4990:Cep295 UTSW 9 15332138 missense probably damaging 1.00
R5057:Cep295 UTSW 9 15322683 missense probably benign 0.00
R5153:Cep295 UTSW 9 15357629 missense probably benign 0.32
R5180:Cep295 UTSW 9 15332120 missense probably benign
R5285:Cep295 UTSW 9 15322591 missense probably benign 0.14
R5360:Cep295 UTSW 9 15326733 missense probably damaging 1.00
R5419:Cep295 UTSW 9 15324237 missense probably damaging 0.98
R5432:Cep295 UTSW 9 15351695 missense possibly damaging 0.95
R5625:Cep295 UTSW 9 15340891 missense probably damaging 0.99
R5637:Cep295 UTSW 9 15333812 unclassified probably null
R5645:Cep295 UTSW 9 15332794 missense probably damaging 0.98
R5645:Cep295 UTSW 9 15335108 missense possibly damaging 0.89
R5678:Cep295 UTSW 9 15322858 missense probably damaging 0.99
R5688:Cep295 UTSW 9 15331986 missense probably damaging 1.00
R5807:Cep295 UTSW 9 15332532 missense probably damaging 1.00
R5824:Cep295 UTSW 9 15325656 missense possibly damaging 0.90
R5837:Cep295 UTSW 9 15346984 missense probably damaging 0.99
R5915:Cep295 UTSW 9 15341479 missense probably damaging 1.00
R5988:Cep295 UTSW 9 15341474 missense probably damaging 1.00
R6239:Cep295 UTSW 9 15322631 missense possibly damaging 0.46
R6332:Cep295 UTSW 9 15334914 missense possibly damaging 0.90
R6383:Cep295 UTSW 9 15332754 missense probably damaging 0.99
R6737:Cep295 UTSW 9 15332351 missense possibly damaging 0.90
R6929:Cep295 UTSW 9 15333062 missense probably damaging 1.00
R7428:Cep295 UTSW 9 15333498 missense possibly damaging 0.61
R7697:Cep295 UTSW 9 15354710 missense probably benign 0.01
X0065:Cep295 UTSW 9 15322891 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CACCCTGCTGAGCTGTAATAG -3'
(R):5'- TCACAAGAACGTCAGTGGCAG -3'

Sequencing Primer
(F):5'- TCTCTGAGGATGACAAAGGTTGATC -3'
(R):5'- AAGAACGTCAGTGGCAGTTCTCTC -3'
Posted On2015-09-24