Incidental Mutation 'R0064:Man1a2'
ID 34393
Institutional Source Beutler Lab
Gene Symbol Man1a2
Ensembl Gene ENSMUSG00000008763
Gene Name mannosidase, alpha, class 1A, member 2
Synonyms Man1b
MMRRC Submission 038356-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0064 (G1)
Quality Score 176
Status Validated
Chromosome 3
Chromosomal Location 100562208-100685503 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100591883 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 412 (S412T)
Ref Sequence ENSEMBL: ENSMUSP00000008907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008907]
AlphaFold P39098
Predicted Effect possibly damaging
Transcript: ENSMUST00000008907
AA Change: S412T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000008907
Gene: ENSMUSG00000008763
AA Change: S412T

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
coiled coil region 101 153 N/A INTRINSIC
low complexity region 155 170 N/A INTRINSIC
Pfam:Glyco_hydro_47 187 626 2.8e-156 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197836
Meta Mutation Damage Score 0.0999 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-mannosidases function at different stages of N-glycan maturation in mammalian cells. See MAN2A1 (MIM 154582) for general information.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress and death within a few hours after birth. Lung development is delayed, the alveolar septum is thickened, and hemorrhage occurs in the alveolar region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Man1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Man1a2 APN 3 100644557 missense probably damaging 1.00
IGL02009:Man1a2 APN 3 100684662 missense probably damaging 0.99
IGL02097:Man1a2 APN 3 100582131 missense possibly damaging 0.68
IGL02395:Man1a2 APN 3 100644537 splice site probably null
IGL02441:Man1a2 APN 3 100591873 missense probably benign 0.01
R0043:Man1a2 UTSW 3 100587880 missense probably damaging 1.00
R0217:Man1a2 UTSW 3 100617037 missense possibly damaging 0.61
R0266:Man1a2 UTSW 3 100582034 missense probably damaging 1.00
R0284:Man1a2 UTSW 3 100684786 missense probably damaging 0.98
R0633:Man1a2 UTSW 3 100684575 missense possibly damaging 0.80
R1074:Man1a2 UTSW 3 100656086 missense possibly damaging 0.68
R2167:Man1a2 UTSW 3 100591900 missense probably damaging 1.00
R2177:Man1a2 UTSW 3 100632531 missense probably damaging 1.00
R3822:Man1a2 UTSW 3 100632597 missense possibly damaging 0.48
R4361:Man1a2 UTSW 3 100656042 missense probably benign
R4652:Man1a2 UTSW 3 100632561 missense probably damaging 1.00
R4871:Man1a2 UTSW 3 100617056 missense probably damaging 1.00
R5153:Man1a2 UTSW 3 100656263 missense probably damaging 1.00
R5182:Man1a2 UTSW 3 100647017 missense probably damaging 0.99
R5201:Man1a2 UTSW 3 100617012 missense probably benign
R5251:Man1a2 UTSW 3 100620099 missense probably damaging 1.00
R6135:Man1a2 UTSW 3 100684932 start gained probably benign
R6793:Man1a2 UTSW 3 100632597 missense possibly damaging 0.48
R6886:Man1a2 UTSW 3 100656071 missense probably benign 0.00
R7209:Man1a2 UTSW 3 100647079 missense unknown
R7224:Man1a2 UTSW 3 100582053 missense possibly damaging 0.85
R7308:Man1a2 UTSW 3 100620105 missense probably damaging 1.00
R7815:Man1a2 UTSW 3 100656179 missense probably damaging 0.99
R7826:Man1a2 UTSW 3 100582139 missense probably damaging 1.00
R8427:Man1a2 UTSW 3 100684685 missense probably benign 0.18
R9621:Man1a2 UTSW 3 100684645 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ccactgcccATTACATTTCTTTATTCAAAGAC -3'
(R):5'- GACACGTATTTTGTTGTACTCCTACTTGACT -3'

Sequencing Primer
(F):5'- ATGTGTAGGCTCAAGCCATC -3'
(R):5'- CATGCCACTATGATTAACTGATCTG -3'
Posted On 2013-05-09