Mutagenetix > Incidental Mutations

Incidental Mutation 'R0064:Tie1'

34394

Institutional Source

Beutler Lab

Gene Symbol

Tie1

Ensembl Gene

ENSMUSG00000033191

Gene Name

tyrosine kinase with immunoglobulin-like and EGF-like domains 1

Synonyms

TIE, D430008P04Rik, tie-1

MMRRC Submission

038356-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0064 (G1)

Quality Score

117

Status

Validated

Chromosome

Chromosomal Location

118471191-118490061 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118489701 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2 (V2A)

Ref Sequence

ENSEMBL: ENSMUSP00000139279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047421] [ENSMUST00000184261]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047421
AA Change: V2A

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000037129
Gene: ENSMUSG00000033191
AA Change: V2A

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	129	211	1.58e-1	SMART
EGF	221	254	1.47e-3	SMART
EGF_like	265	301	7.23e1	SMART
EGF	312	343	8.52e0	SMART
IG	355	442	1.92e0	SMART
FN3	445	528	2.68e-2	SMART
FN3	544	627	4.1e0	SMART
FN3	640	722	6.95e-10	SMART
transmembrane domain	760	782	N/A	INTRINSIC
TyrKc	835	1103	5.05e-134	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000117834

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153286

Predicted Effect

possibly damaging
Transcript: ENSMUST00000184261
AA Change: V2A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139279
Gene: ENSMUSG00000033191
AA Change: V2A

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
IG	129	211	1.58e-1	SMART
EGF	221	254	1.47e-3	SMART
EGF_like	265	301	7.23e1	SMART
EGF	312	343	8.52e0	SMART
IG	355	442	1.92e0	SMART
FN3	445	528	2.68e-2	SMART
FN3	544	627	4.1e0	SMART

Meta Mutation Damage Score

0.0959

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic or neonatal lethality, hemorrhages, edema, increased vascular branching, and abnormal vascular endothelial cell development. Mice homozygous for a hypomorphic allele exhibit dilated and disorganized lymphatic vessel, edema, and hemorrhage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	C	11: 110,144,871	L641R	probably damaging	Het
Abca9	G	T	11: 110,144,872	L641M	probably damaging	Het
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Arhgef17	C	A	7: 100,881,354	M1408I	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cdon	A	G	9: 35,489,227	H1079R	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nlrc3	G	T	16: 3,964,087	T486K	possibly damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Plce1	T	C	19: 38,780,784		probably null	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Thbs1	A	T	2: 118,123,914		probably null	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Vmn2r111	T	A	17: 22,572,072	I82L	probably benign	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Tie1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01419:Tie1	APN	4	118476098	missense	probably damaging	1.00
IGL01679:Tie1	APN	4	118482739	missense	probably benign	0.00
IGL01821:Tie1	APN	4	118484638	missense	probably damaging	0.99
IGL01892:Tie1	APN	4	118475918	missense	probably benign
IGL02101:Tie1	APN	4	118472798	missense	probably benign	0.42
IGL02411:Tie1	APN	4	118486563	nonsense	probably null
IGL02421:Tie1	APN	4	118486394	missense	probably damaging	1.00
IGL02892:Tie1	APN	4	118486282	missense	probably damaging	1.00
IGL03294:Tie1	APN	4	118480223	missense	probably damaging	1.00
IGL03346:Tie1	APN	4	118472828	missense	probably damaging	1.00
R0067:Tie1	UTSW	4	118476280	splice site	probably benign
R0080:Tie1	UTSW	4	118484353	missense	probably damaging	1.00
R0082:Tie1	UTSW	4	118484353	missense	probably damaging	1.00
R0098:Tie1	UTSW	4	118486587	missense	probably benign
R0329:Tie1	UTSW	4	118484727	missense	probably benign	0.24
R0330:Tie1	UTSW	4	118484727	missense	probably benign	0.24
R0410:Tie1	UTSW	4	118480569	missense	probably damaging	1.00
R0472:Tie1	UTSW	4	118476147	missense	possibly damaging	0.61
R0498:Tie1	UTSW	4	118479161	utr 3 prime	probably benign
R0521:Tie1	UTSW	4	118476146	missense	probably damaging	1.00
R0609:Tie1	UTSW	4	118476147	missense	possibly damaging	0.61
R0675:Tie1	UTSW	4	118479769	nonsense	probably null
R0830:Tie1	UTSW	4	118482663	missense	probably damaging	1.00
R1541:Tie1	UTSW	4	118483873	missense	probably damaging	0.99
R1604:Tie1	UTSW	4	118474407	missense	probably damaging	1.00
R1731:Tie1	UTSW	4	118476263	missense	probably damaging	1.00
R1751:Tie1	UTSW	4	118476176	missense	possibly damaging	0.87
R1767:Tie1	UTSW	4	118476176	missense	possibly damaging	0.87
R1953:Tie1	UTSW	4	118472790	critical splice donor site	probably null
R1986:Tie1	UTSW	4	118478963	missense	probably benign
R2141:Tie1	UTSW	4	118472811	nonsense	probably null
R3150:Tie1	UTSW	4	118475825	missense	probably damaging	1.00
R4235:Tie1	UTSW	4	118478405	nonsense	probably null
R4599:Tie1	UTSW	4	118472634	missense	probably benign	0.00
R4614:Tie1	UTSW	4	118479051	missense	probably damaging	1.00
R4623:Tie1	UTSW	4	118486611	missense	possibly damaging	0.71
R4638:Tie1	UTSW	4	118483842	missense	probably benign	0.00
R4717:Tie1	UTSW	4	118486217	missense	probably damaging	1.00
R4936:Tie1	UTSW	4	118484771	splice site	silent
R4983:Tie1	UTSW	4	118483755	missense	probably damaging	1.00
R5202:Tie1	UTSW	4	118480510	missense	probably benign	0.01
R5234:Tie1	UTSW	4	118482762	missense	probably benign	0.22
R5243:Tie1	UTSW	4	118482351	missense	probably damaging	0.99
R5538:Tie1	UTSW	4	118486193	missense	probably benign	0.10
R5881:Tie1	UTSW	4	118475603	missense	possibly damaging	0.89
R6045:Tie1	UTSW	4	118484691	missense	probably benign	0.05
R6073:Tie1	UTSW	4	118482390	missense	probably benign
R6476:Tie1	UTSW	4	118472865	missense	possibly damaging	0.82
R6820:Tie1	UTSW	4	118484386	missense	probably damaging	1.00
R6961:Tie1	UTSW	4	118486205	missense	probably damaging	1.00
R7022:Tie1	UTSW	4	118489653	missense	probably benign	0.00
R7029:Tie1	UTSW	4	118484626	missense	possibly damaging	0.93
R7147:Tie1	UTSW	4	118484413	missense	probably damaging	1.00
R7249:Tie1	UTSW	4	118486228	missense	probably benign	0.29
R7410:Tie1	UTSW	4	118479877	missense	probably benign
R7486:Tie1	UTSW	4	118479904	critical splice acceptor site	probably null
R7637:Tie1	UTSW	4	118472978	missense	probably damaging	1.00
R7737:Tie1	UTSW	4	118478857	splice site	probably null
R7878:Tie1	UTSW	4	118478424	missense	probably damaging	1.00
R8012:Tie1	UTSW	4	118486481	missense	possibly damaging	0.77
Z1088:Tie1	UTSW	4	118484429	missense	probably damaging	1.00
Z1176:Tie1	UTSW	4	118474177	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGCTATGACGACGACGATGATG -3'
(R):5'- AGGACTACAGGCGACAACTCTTCC -3'

Sequencing Primer
(F):5'- acatcaccacccatttccac -3'
(R):5'- GCGACAACTCTTCCCACCC -3'

Posted On

2013-05-09