Incidental Mutation 'R4585:Ercc5'
ID 343973
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms Xpg
MMRRC Submission 041806-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4585 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 44147744-44181260 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 44158857 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 145 (V145I)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027214
AA Change: V145I

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: V145I

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155862
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Akr7a5 G T 4: 139,310,927 R58L probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Aurkaip1 C A 4: 155,832,634 A113D possibly damaging Het
Bsn T C 9: 108,110,463 probably benign Het
Ccdc175 T G 12: 72,175,179 D123A possibly damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Ccnt2 T C 1: 127,803,029 S548P probably damaging Het
Cep126 T C 9: 8,103,337 Q224R probably damaging Het
Cic A T 7: 25,272,778 I645L probably benign Het
Cngb1 C T 8: 95,297,128 probably null Het
Col13a1 T C 10: 61,887,245 probably null Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Crebrf A G 17: 26,762,255 K535R probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cxcr5 T A 9: 44,514,145 I72F probably benign Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dlgap2 G A 8: 14,727,999 probably null Het
Dnah8 A G 17: 30,751,567 D2684G probably benign Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 G A 18: 6,441,157 Q14* probably null Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Glra3 C A 8: 56,088,993 T257K probably damaging Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm19965 T A 1: 116,821,778 N396K probably benign Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gmcl1 A G 6: 86,722,623 S141P probably damaging Het
Gsdmd T A 15: 75,865,751 probably null Het
Gtf2a1 C T 12: 91,562,926 V338I possibly damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Lctl T C 9: 64,131,600 S324P probably damaging Het
Lrrc24 C A 15: 76,723,689 R43L probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mroh5 T A 15: 73,789,271 T467S probably benign Het
Mtap G A 4: 89,172,274 V194I probably benign Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pabpc6 A G 17: 9,669,073 L183P probably damaging Het
Pcdh15 C T 10: 74,624,284 R1355W probably damaging Het
Pcdhgb8 C A 18: 37,762,360 A161E probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Phc2 A T 4: 128,743,510 H563L probably damaging Het
Plekha2 C A 8: 25,043,669 E291* probably null Het
Qser1 C A 2: 104,786,793 V1225L probably benign Het
Ralgapa2 A T 2: 146,315,024 D1882E probably damaging Het
Rgs17 T C 10: 5,842,596 D70G probably benign Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Scn2a T A 2: 65,743,051 probably null Het
Serpinb10 T A 1: 107,547,049 C314S probably benign Het
Setbp1 A C 18: 79,086,949 S23A probably benign Het
Sh3pxd2b A G 11: 32,396,479 D116G possibly damaging Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx19 T C 9: 30,440,195 L155P probably damaging Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Strn3 T A 12: 51,650,170 E259D probably benign Het
Tenm1 G A X: 42,537,979 Q1931* probably null Het
Trp53bp1 C G 2: 121,207,951 G1469R probably damaging Het
Ttc8 C A 12: 98,982,530 Q492K probably benign Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Utrn T A 10: 12,688,306 H1270L probably benign Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdfy4 T A 14: 33,087,955 I1770F possibly damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R2680:Ercc5 UTSW 1 44156973 missense probably benign 0.09
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7486:Ercc5 UTSW 1 44148064 start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44178334 missense possibly damaging 0.94
R8432:Ercc5 UTSW 1 44167681 nonsense probably null
R8795:Ercc5 UTSW 1 44163929 missense possibly damaging 0.92
R9144:Ercc5 UTSW 1 44174351 missense probably damaging 1.00
R9208:Ercc5 UTSW 1 44178343 missense possibly damaging 0.51
R9295:Ercc5 UTSW 1 44158857 missense probably damaging 1.00
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGGAAAAGTCAGCCATTGTCC -3'
(R):5'- AGTTATCCTAGAAGACAGATCCAC -3'

Sequencing Primer
(F):5'- GAAAAGTCAGCCATTGTCCTTGAGC -3'
(R):5'- GAGACCTCCCAATCTGACATTATAGG -3'
Posted On 2015-09-24