Mutagenetix > Incidental Mutations

Incidental Mutation 'R4585:Ercc5'

343973

Institutional Source

Beutler Lab

Gene Symbol

Ercc5

Ensembl Gene

ENSMUSG00000026048

Gene Name

excision repair cross-complementing rodent repair deficiency, complementation group 5

Synonyms

Xpg

MMRRC Submission

041806-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4585 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44147744-44181260 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 44158857 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 145 (V145I)

Ref Sequence

ENSEMBL: ENSMUSP00000027214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027214]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027214
AA Change: V145I

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: V145I

Domain	Start	End	E-Value	Type
XPGN	1	98	3.49e-50	SMART
low complexity region	104	115	N/A	INTRINSIC
low complexity region	151	163	N/A	INTRINSIC
low complexity region	305	326	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
low complexity region	641	650	N/A	INTRINSIC
XPGI	776	845	1.02e-33	SMART
HhH2	847	880	2.94e-11	SMART
low complexity region	1130	1140	N/A	INTRINSIC
low complexity region	1155	1169	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131177

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137380

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139510

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145406

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155862

Meta Mutation Damage Score

0.0636

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	T	C	5: 3,976,151	S1269P	probably benign	Het
Akr7a5	G	T	4: 139,310,927	R58L	probably benign	Het
Art2a-ps	A	T	7: 101,554,749	L194*	probably null	Het
Aurkaip1	C	A	4: 155,832,634	A113D	possibly damaging	Het
Bsn	T	C	9: 108,110,463		probably benign	Het
Ccdc175	T	G	12: 72,175,179	D123A	possibly damaging	Het
Ccdc7b	A	G	8: 129,110,920	T131A	probably benign	Het
Ccnt2	T	C	1: 127,803,029	S548P	probably damaging	Het
Cep126	T	C	9: 8,103,337	Q224R	probably damaging	Het
Cic	A	T	7: 25,272,778	I645L	probably benign	Het
Cngb1	C	T	8: 95,297,128		probably null	Het
Col13a1	T	C	10: 61,887,245		probably null	Het
Corin	A	T	5: 72,329,699	V706D	probably damaging	Het
Crebrf	A	G	17: 26,762,255	K535R	probably damaging	Het
Cuzd1	G	A	7: 131,314,800	P310L	probably damaging	Het
Cxcr5	T	A	9: 44,514,145	I72F	probably benign	Het
Dapp1	T	C	3: 137,939,171	Q148R	probably benign	Het
Dcaf17	T	A	2: 71,088,580	S499R	probably benign	Het
Defb3	A	T	8: 19,295,156	I43F	possibly damaging	Het
Dlgap2	G	A	8: 14,727,999		probably null	Het
Dnah8	A	G	17: 30,751,567	D2684G	probably benign	Het
Dnajc10	T	G	2: 80,347,778	F710V	probably damaging	Het
Ep400	G	A	5: 110,753,859	T464I	probably damaging	Het
Epc1	G	A	18: 6,441,157	Q14*	probably null	Het
Eral1	A	T	11: 78,078,304	N123K	probably damaging	Het
Evc	A	G	5: 37,323,713	S263P	probably damaging	Het
Fancc	A	T	13: 63,347,564	M182K	probably benign	Het
Fbxl3	G	T	14: 103,083,090	A355E	probably damaging	Het
Glra3	C	A	8: 56,088,993	T257K	probably damaging	Het
Gm12789	A	G	4: 101,989,962	Y148C	possibly damaging	Het
Gm14393	C	A	2: 175,062,704		probably benign	Het
Gm19965	T	A	1: 116,821,778	N396K	probably benign	Het
Gm27013	A	T	6: 130,521,040		noncoding transcript	Het
Gmcl1	A	G	6: 86,722,623	S141P	probably damaging	Het
Gsdmd	T	A	15: 75,865,751		probably null	Het
Gtf2a1	C	T	12: 91,562,926	V338I	possibly damaging	Het
Hap1	G	A	11: 100,354,724	T138M	probably benign	Het
Hist1h2ak	T	C	13: 21,753,712	N39S	possibly damaging	Het
Ints2	G	T	11: 86,249,275	R244S	probably damaging	Het
Itgb4	T	C	11: 115,993,325	V945A	probably damaging	Het
Itih2	C	T	2: 10,110,400	S387N	probably benign	Het
Klra2	T	A	6: 131,230,157	D163V	probably benign	Het
Lctl	T	C	9: 64,131,600	S324P	probably damaging	Het
Lrrc24	C	A	15: 76,723,689	R43L	probably damaging	Het
Mogs	G	T	6: 83,118,638	R812L	possibly damaging	Het
Mroh5	T	A	15: 73,789,271	T467S	probably benign	Het
Mtap	G	A	4: 89,172,274	V194I	probably benign	Het
Myoz1	A	G	14: 20,650,595	W185R	probably damaging	Het
Nufip2	T	C	11: 77,741,728	V690A	unknown	Het
Obox1	A	T	7: 15,556,227	N165I	possibly damaging	Het
Olfr1218	T	G	2: 89,055,154	I91L	possibly damaging	Het
Olfr3	C	T	2: 36,812,525	C189Y	probably damaging	Het
Olfr32	T	A	2: 90,138,214	E308D	probably benign	Het
Olfr781	A	G	10: 129,333,273	T131A	probably benign	Het
Pabpc6	A	G	17: 9,669,073	L183P	probably damaging	Het
Pcdh15	C	T	10: 74,624,284	R1355W	probably damaging	Het
Pcdhgb8	C	A	18: 37,762,360	A161E	probably benign	Het
Pex1	A	G	5: 3,633,885	Y1127C	probably damaging	Het
Phc2	A	T	4: 128,743,510	H563L	probably damaging	Het
Plekha2	C	A	8: 25,043,669	E291*	probably null	Het
Qser1	C	A	2: 104,786,793	V1225L	probably benign	Het
Ralgapa2	A	T	2: 146,315,024	D1882E	probably damaging	Het
Rgs17	T	C	10: 5,842,596	D70G	probably benign	Het
Runx1t1	A	T	4: 13,889,864	T598S	unknown	Het
Scn2a	T	A	2: 65,743,051		probably null	Het
Serpinb10	T	A	1: 107,547,049	C314S	probably benign	Het
Setbp1	A	C	18: 79,086,949	S23A	probably benign	Het
Sh3pxd2b	A	G	11: 32,396,479	D116G	possibly damaging	Het
Slc4a1	G	T	11: 102,361,419		probably benign	Het
Snx19	T	C	9: 30,440,195	L155P	probably damaging	Het
Sox2	A	G	3: 34,651,044	N210S	probably benign	Het
Spag6	T	C	2: 18,732,147		probably null	Het
Speer4b	A	T	5: 27,498,038	L154Q	probably null	Het
Strn3	T	A	12: 51,650,170	E259D	probably benign	Het
Tenm1	G	A	X: 42,537,979	Q1931*	probably null	Het
Trp53bp1	C	G	2: 121,207,951	G1469R	probably damaging	Het
Ttc8	C	A	12: 98,982,530	Q492K	probably benign	Het
Ttn	T	C	2: 76,968,403	H509R	probably benign	Het
Utrn	T	A	10: 12,688,306	H1270L	probably benign	Het
Vopp1	G	A	6: 57,754,548	P153S	probably damaging	Het
Wdfy4	T	A	14: 33,087,955	I1770F	possibly damaging	Het
Zfp14	G	T	7: 30,038,916	Q215K	probably damaging	Het
Zfp473	A	T	7: 44,732,952	Y651*	probably null	Het
Zfp735	G	T	11: 73,689,724	E16D	possibly damaging	Het

Other mutations in Ercc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Ercc5	APN	1	44163898	missense	probably damaging	1.00
IGL00782:Ercc5	APN	1	44163935	missense	probably damaging	1.00
IGL01418:Ercc5	APN	1	44167280	missense	probably benign	0.43
IGL01710:Ercc5	APN	1	44164075	missense	probably damaging	1.00
IGL02528:Ercc5	APN	1	44167802	missense	probably benign	0.00
IGL02589:Ercc5	APN	1	44164049	missense	probably damaging	1.00
IGL02651:Ercc5	APN	1	44156944	missense	probably damaging	1.00
IGL02740:Ercc5	APN	1	44167492	missense	probably benign	0.00
IGL02999:Ercc5	APN	1	44167654	missense	probably benign	0.00
IGL03057:Ercc5	APN	1	44167001	missense	probably damaging	0.99
IGL03246:Ercc5	APN	1	44167081	missense	probably damaging	1.00
R0084:Ercc5	UTSW	1	44175976	missense	possibly damaging	0.53
R0448:Ercc5	UTSW	1	44173940	missense	probably damaging	1.00
R1120:Ercc5	UTSW	1	44161841	missense	probably damaging	1.00
R1312:Ercc5	UTSW	1	44164019	missense	probably damaging	1.00
R1411:Ercc5	UTSW	1	44178281	missense	probably damaging	0.99
R1462:Ercc5	UTSW	1	44180624	missense	probably damaging	0.98
R1462:Ercc5	UTSW	1	44180624	missense	probably damaging	0.98
R1528:Ercc5	UTSW	1	44178241	nonsense	probably null
R1637:Ercc5	UTSW	1	44167534	missense	probably benign	0.00
R1668:Ercc5	UTSW	1	44167033	missense	probably benign	0.04
R1714:Ercc5	UTSW	1	44167339	missense	probably benign	0.01
R1780:Ercc5	UTSW	1	44167796	missense	probably benign	0.17
R1800:Ercc5	UTSW	1	44173380	missense	probably benign	0.00
R1835:Ercc5	UTSW	1	44180875	missense	probably benign	0.00
R1836:Ercc5	UTSW	1	44180875	missense	probably benign	0.00
R1886:Ercc5	UTSW	1	44175976	nonsense	probably null
R2344:Ercc5	UTSW	1	44167169	missense	probably benign
R2680:Ercc5	UTSW	1	44156973	missense	probably benign	0.09
R3033:Ercc5	UTSW	1	44180574	missense	possibly damaging	0.83
R3919:Ercc5	UTSW	1	44161931	missense	probably damaging	1.00
R3933:Ercc5	UTSW	1	44167856	missense	probably benign	0.17
R4444:Ercc5	UTSW	1	44158209	frame shift	probably null
R4578:Ercc5	UTSW	1	44148148	missense	probably benign	0.32
R4586:Ercc5	UTSW	1	44158857	missense	probably benign	0.36
R4911:Ercc5	UTSW	1	44166871	missense	possibly damaging	0.66
R4912:Ercc5	UTSW	1	44157057	missense	probably damaging	1.00
R4942:Ercc5	UTSW	1	44175965	missense	probably benign	0.09
R5155:Ercc5	UTSW	1	44180622	missense	probably damaging	1.00
R5975:Ercc5	UTSW	1	44173406	missense	probably benign	0.04
R5991:Ercc5	UTSW	1	44180830	nonsense	probably null
R6161:Ercc5	UTSW	1	44167352	missense	probably benign	0.00
R6250:Ercc5	UTSW	1	44164049	missense	probably damaging	1.00
R7142:Ercc5	UTSW	1	44174214	missense	probably damaging	1.00
R7183:Ercc5	UTSW	1	44161808	critical splice acceptor site	probably null
R7183:Ercc5	UTSW	1	44161809	critical splice acceptor site	probably null
R7235:Ercc5	UTSW	1	44178203	missense	possibly damaging	0.68
R7349:Ercc5	UTSW	1	44180908	missense	possibly damaging	0.56
R7369:Ercc5	UTSW	1	44180860	missense	probably benign	0.39
R7486:Ercc5	UTSW	1	44148064	start codon destroyed	probably null	1.00
R7586:Ercc5	UTSW	1	44175851	missense	possibly damaging	0.49
R7904:Ercc5	UTSW	1	44175838	critical splice acceptor site	probably null
R7994:Ercc5	UTSW	1	44178334	missense	possibly damaging	0.94
R8432:Ercc5	UTSW	1	44167681	nonsense	probably null
R8795:Ercc5	UTSW	1	44163929	missense	possibly damaging	0.92
R9144:Ercc5	UTSW	1	44174351	missense	probably damaging	1.00
R9208:Ercc5	UTSW	1	44178343	missense	possibly damaging	0.51
R9295:Ercc5	UTSW	1	44158857	missense	probably damaging	1.00
X0011:Ercc5	UTSW	1	44180622	missense	probably damaging	1.00
X0062:Ercc5	UTSW	1	44173974	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGGAAAAGTCAGCCATTGTCC -3'
(R):5'- AGTTATCCTAGAAGACAGATCCAC -3'

Sequencing Primer
(F):5'- GAAAAGTCAGCCATTGTCCTTGAGC -3'
(R):5'- GAGACCTCCCAATCTGACATTATAGG -3'

Posted On

2015-09-24