Incidental Mutation 'R4585:Dnajc10'
ID343984
Institutional Source Beutler Lab
Gene Symbol Dnajc10
Ensembl Gene ENSMUSG00000027006
Gene NameDnaJ heat shock protein family (Hsp40) member C10
SynonymsJPDI, ERdj5, D2Ertd706e, 1200006L06Rik
MMRRC Submission 041806-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R4585 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location80315466-80354043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 80347778 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 710 (F710V)
Ref Sequence ENSEMBL: ENSMUSP00000028392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028392]
PDB Structure
Crystal structure of full-length ERdj5 [X-RAY DIFFRACTION]
Crystal structure of J-Trx1 fragment of ERdj5 [X-RAY DIFFRACTION]
Crystal structure of Trx4 domain of ERdj5 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028392
AA Change: F710V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028392
Gene: ENSMUSG00000027006
AA Change: F710V

DomainStartEndE-ValueType
DnaJ 34 92 9.73e-26 SMART
Pfam:Thioredoxin 130 232 5.6e-21 PFAM
low complexity region 384 392 N/A INTRINSIC
Pfam:Thioredoxin 454 553 2.3e-21 PFAM
Pfam:Thioredoxin 557 663 2e-21 PFAM
Pfam:Thioredoxin 672 776 5.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154912
Meta Mutation Damage Score 0.7420 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum co-chaperone which is part of the endoplasmic reticulum-associated degradation complex involved in recognizing and degrading misfolded proteins. The encoded protein reduces incorrect disulfide bonds in misfolded glycoproteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased endoplasmic reticulum stress in the salivary gland. Female homozygous mutant mice are smaller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Akr7a5 G T 4: 139,310,927 R58L probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Aurkaip1 C A 4: 155,832,634 A113D possibly damaging Het
Bsn T C 9: 108,110,463 probably benign Het
Ccdc175 T G 12: 72,175,179 D123A possibly damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Ccnt2 T C 1: 127,803,029 S548P probably damaging Het
Cep126 T C 9: 8,103,337 Q224R probably damaging Het
Cic A T 7: 25,272,778 I645L probably benign Het
Cngb1 C T 8: 95,297,128 probably null Het
Col13a1 T C 10: 61,887,245 probably null Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Crebrf A G 17: 26,762,255 K535R probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cxcr5 T A 9: 44,514,145 I72F probably benign Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dlgap2 G A 8: 14,727,999 probably null Het
Dnah8 A G 17: 30,751,567 D2684G probably benign Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 G A 18: 6,441,157 Q14* probably null Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Ercc5 G A 1: 44,158,857 V145I probably benign Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Glra3 C A 8: 56,088,993 T257K probably damaging Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm19965 T A 1: 116,821,778 N396K probably benign Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gmcl1 A G 6: 86,722,623 S141P probably damaging Het
Gsdmd T A 15: 75,865,751 probably null Het
Gtf2a1 C T 12: 91,562,926 V338I possibly damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Lctl T C 9: 64,131,600 S324P probably damaging Het
Lrrc24 C A 15: 76,723,689 R43L probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mroh5 T A 15: 73,789,271 T467S probably benign Het
Mtap G A 4: 89,172,274 V194I probably benign Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pabpc6 A G 17: 9,669,073 L183P probably damaging Het
Pcdh15 C T 10: 74,624,284 R1355W probably damaging Het
Pcdhgb8 C A 18: 37,762,360 A161E probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Phc2 A T 4: 128,743,510 H563L probably damaging Het
Plekha2 C A 8: 25,043,669 E291* probably null Het
Qser1 C A 2: 104,786,793 V1225L probably benign Het
Ralgapa2 A T 2: 146,315,024 D1882E probably damaging Het
Rgs17 T C 10: 5,842,596 D70G probably benign Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Scn2a T A 2: 65,743,051 probably null Het
Serpinb10 T A 1: 107,547,049 C314S probably benign Het
Setbp1 A C 18: 79,086,949 S23A probably benign Het
Sh3pxd2b A G 11: 32,396,479 D116G possibly damaging Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx19 T C 9: 30,440,195 L155P probably damaging Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Strn3 T A 12: 51,650,170 E259D probably benign Het
Tenm1 G A X: 42,537,979 Q1931* probably null Het
Trp53bp1 C G 2: 121,207,951 G1469R probably damaging Het
Ttc8 C A 12: 98,982,530 Q492K probably benign Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Utrn T A 10: 12,688,306 H1270L probably benign Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdfy4 T A 14: 33,087,955 I1770F possibly damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Other mutations in Dnajc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Dnajc10 APN 2 80324752 splice site probably benign
IGL01420:Dnajc10 APN 2 80345023 missense possibly damaging 0.81
IGL01466:Dnajc10 APN 2 80321287 missense probably benign 0.00
IGL01645:Dnajc10 APN 2 80340527 missense possibly damaging 0.46
IGL01929:Dnajc10 APN 2 80328076 missense probably damaging 0.99
IGL01958:Dnajc10 APN 2 80321304 splice site probably benign
IGL02205:Dnajc10 APN 2 80349358 missense possibly damaging 0.74
IGL02289:Dnajc10 APN 2 80340526 missense probably damaging 0.98
IGL02661:Dnajc10 APN 2 80326740 splice site probably benign
IGL02865:Dnajc10 APN 2 80331303 missense probably benign
IGL03026:Dnajc10 APN 2 80349303 missense probably damaging 0.96
IGL03407:Dnajc10 APN 2 80346641 missense probably damaging 1.00
PIT4283001:Dnajc10 UTSW 2 80331395 missense probably benign 0.19
R0092:Dnajc10 UTSW 2 80325682 missense probably damaging 0.97
R0457:Dnajc10 UTSW 2 80344946 missense possibly damaging 0.65
R1414:Dnajc10 UTSW 2 80347677 missense probably damaging 0.99
R1739:Dnajc10 UTSW 2 80347662 missense probably benign 0.03
R2126:Dnajc10 UTSW 2 80350734 critical splice donor site probably null
R3717:Dnajc10 UTSW 2 80324745 splice site probably benign
R3718:Dnajc10 UTSW 2 80324745 splice site probably benign
R4020:Dnajc10 UTSW 2 80344952 missense probably damaging 1.00
R4453:Dnajc10 UTSW 2 80346623 missense probably damaging 0.98
R4586:Dnajc10 UTSW 2 80347778 missense probably damaging 1.00
R4772:Dnajc10 UTSW 2 80340526 missense probably damaging 0.98
R5653:Dnajc10 UTSW 2 80349368 missense probably damaging 1.00
R6157:Dnajc10 UTSW 2 80317391 start gained probably benign
R6263:Dnajc10 UTSW 2 80343948 missense probably damaging 1.00
R6303:Dnajc10 UTSW 2 80350664 missense probably benign 0.07
R6932:Dnajc10 UTSW 2 80331336 missense probably benign
R7104:Dnajc10 UTSW 2 80340815 missense probably damaging 1.00
R7181:Dnajc10 UTSW 2 80319243 nonsense probably null
R7458:Dnajc10 UTSW 2 80324750 splice site probably null
R7842:Dnajc10 UTSW 2 80345065 missense probably benign 0.04
R7925:Dnajc10 UTSW 2 80345065 missense probably benign 0.04
X0018:Dnajc10 UTSW 2 80350674 missense probably damaging 0.97
X0024:Dnajc10 UTSW 2 80344962 missense probably benign 0.19
Z1177:Dnajc10 UTSW 2 80319233 missense not run
Predicted Primers PCR Primer
(F):5'- CAGTGTTGCTGTATGTAATGCTTAC -3'
(R):5'- CACACTCGGACCCTTGTAATCTG -3'

Sequencing Primer
(F):5'- GCTTACAGTAATGCTTACAGTATTGC -3'
(R):5'- TTCCAGTCAGCCAGGGTTATAAAG -3'
Posted On2015-09-24