Incidental Mutation 'R4585:Olfr1218'
ID343985
Institutional Source Beutler Lab
Gene Symbol Olfr1218
Ensembl Gene ENSMUSG00000075105
Gene Nameolfactory receptor 1218
SynonymsGA_x6K02T2Q125-50536041-50535106, MOR233-12
MMRRC Submission 041806-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4585 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89052296-89061187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89055154 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 91 (I91L)
Ref Sequence ENSEMBL: ENSMUSP00000149671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099798] [ENSMUST00000213609] [ENSMUST00000215048] [ENSMUST00000215054]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099798
AA Change: I91L

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097386
Gene: ENSMUSG00000075105
AA Change: I91L

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.4e-45 PFAM
Pfam:7tm_1 39 286 2.2e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213609
AA Change: I91L

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215048
AA Change: I91L

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215054
AA Change: I91L

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.2940 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Akr7a5 G T 4: 139,310,927 R58L probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Aurkaip1 C A 4: 155,832,634 A113D possibly damaging Het
Bsn T C 9: 108,110,463 probably benign Het
Ccdc175 T G 12: 72,175,179 D123A possibly damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Ccnt2 T C 1: 127,803,029 S548P probably damaging Het
Cep126 T C 9: 8,103,337 Q224R probably damaging Het
Cic A T 7: 25,272,778 I645L probably benign Het
Cngb1 C T 8: 95,297,128 probably null Het
Col13a1 T C 10: 61,887,245 probably null Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Crebrf A G 17: 26,762,255 K535R probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cxcr5 T A 9: 44,514,145 I72F probably benign Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dlgap2 G A 8: 14,727,999 probably null Het
Dnah8 A G 17: 30,751,567 D2684G probably benign Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 G A 18: 6,441,157 Q14* probably null Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Ercc5 G A 1: 44,158,857 V145I probably benign Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Glra3 C A 8: 56,088,993 T257K probably damaging Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm19965 T A 1: 116,821,778 N396K probably benign Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gmcl1 A G 6: 86,722,623 S141P probably damaging Het
Gsdmd T A 15: 75,865,751 probably null Het
Gtf2a1 C T 12: 91,562,926 V338I possibly damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Lctl T C 9: 64,131,600 S324P probably damaging Het
Lrrc24 C A 15: 76,723,689 R43L probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mroh5 T A 15: 73,789,271 T467S probably benign Het
Mtap G A 4: 89,172,274 V194I probably benign Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pabpc6 A G 17: 9,669,073 L183P probably damaging Het
Pcdh15 C T 10: 74,624,284 R1355W probably damaging Het
Pcdhgb8 C A 18: 37,762,360 A161E probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Phc2 A T 4: 128,743,510 H563L probably damaging Het
Plekha2 C A 8: 25,043,669 E291* probably null Het
Qser1 C A 2: 104,786,793 V1225L probably benign Het
Ralgapa2 A T 2: 146,315,024 D1882E probably damaging Het
Rgs17 T C 10: 5,842,596 D70G probably benign Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Scn2a T A 2: 65,743,051 probably null Het
Serpinb10 T A 1: 107,547,049 C314S probably benign Het
Setbp1 A C 18: 79,086,949 S23A probably benign Het
Sh3pxd2b A G 11: 32,396,479 D116G possibly damaging Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx19 T C 9: 30,440,195 L155P probably damaging Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Strn3 T A 12: 51,650,170 E259D probably benign Het
Tenm1 G A X: 42,537,979 Q1931* probably null Het
Trp53bp1 C G 2: 121,207,951 G1469R probably damaging Het
Ttc8 C A 12: 98,982,530 Q492K probably benign Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Utrn T A 10: 12,688,306 H1270L probably benign Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdfy4 T A 14: 33,087,955 I1770F possibly damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Other mutations in Olfr1218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Olfr1218 APN 2 89054569 missense probably damaging 1.00
IGL03089:Olfr1218 APN 2 89055013 missense probably benign 0.34
IGL03387:Olfr1218 APN 2 89055113 missense probably damaging 1.00
R0350:Olfr1218 UTSW 2 89055356 missense probably benign 0.10
R0699:Olfr1218 UTSW 2 89055292 missense possibly damaging 0.67
R1609:Olfr1218 UTSW 2 89055344 missense probably benign
R1856:Olfr1218 UTSW 2 89054859 missense possibly damaging 0.95
R1972:Olfr1218 UTSW 2 89054547 missense probably benign 0.05
R2066:Olfr1218 UTSW 2 89054899 missense probably damaging 0.99
R2921:Olfr1218 UTSW 2 89054499 missense probably benign 0.04
R2923:Olfr1218 UTSW 2 89054499 missense probably benign 0.04
R4037:Olfr1218 UTSW 2 89054688 missense probably damaging 0.99
R4586:Olfr1218 UTSW 2 89055154 missense possibly damaging 0.77
R5041:Olfr1218 UTSW 2 89054921 nonsense probably null
R5124:Olfr1218 UTSW 2 89055087 missense probably damaging 0.96
R5138:Olfr1218 UTSW 2 89054947 missense probably benign 0.00
R5415:Olfr1218 UTSW 2 89054896 missense probably benign 0.00
R5501:Olfr1218 UTSW 2 89054886 nonsense probably null
R5941:Olfr1218 UTSW 2 89054619 missense probably benign
R5991:Olfr1218 UTSW 2 89054782 missense probably benign 0.01
R6396:Olfr1218 UTSW 2 89055297 missense probably benign 0.36
R7047:Olfr1218 UTSW 2 89055146 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCAGGATATTGCTACCAAAATG -3'
(R):5'- CTTGGGGCTTTCTCAGAACC -3'

Sequencing Primer
(F):5'- TATTGCTACCAAAATGCTACAGAGC -3'
(R):5'- TGGGGCTTTCTCAGAACCCAATAG -3'
Posted On2015-09-24