Mutagenetix > Incidental Mutation

Incidental Mutation 'R0064:Cic'

34400

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

038356-MU

Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Essential gene?

Probably essential (E-score: 0.945) question?

Stock #

R0064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25267704-25294159 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 25287141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Tyrosine at position 1299 (S1299Y)

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]

AlphaFold

Q924A2

Predicted Effect

probably benign
Transcript: ENSMUST00000005578
AA Change: S392Y

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: S392Y

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1155	N/A	INTRINSIC
low complexity region	1223	1253	N/A	INTRINSIC
low complexity region	1280	1313	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163320
AA Change: S392Y

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: S392Y

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1064	1079	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC
low complexity region	1134	1154	N/A	INTRINSIC
low complexity region	1222	1252	N/A	INTRINSIC
low complexity region	1279	1312	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164440

Predicted Effect

probably benign
Transcript: ENSMUST00000164820

SMART Domains

Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
low complexity region	39	57	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165239
AA Change: S392Y

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: S392Y

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	5e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167162

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168956

Predicted Effect

probably damaging
Transcript: ENSMUST00000169266
AA Change: S1299Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: S1299Y

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170500

Meta Mutation Damage Score

0.0659

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	C	11: 110,144,871	L641R	probably damaging	Het
Abca9	G	T	11: 110,144,872	L641M	probably damaging	Het
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Arhgef17	C	A	7: 100,881,354	M1408I	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cdon	A	G	9: 35,489,227	H1079R	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nlrc3	G	T	16: 3,964,087	T486K	possibly damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Plce1	T	C	19: 38,780,784		probably null	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Thbs1	A	T	2: 118,123,914		probably null	Het
Tie1	A	G	4: 118,489,701	V2A	possibly damaging	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Vmn2r111	T	A	17: 22,572,072	I82L	probably benign	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	25292124	missense	probably damaging	1.00
IGL01668:Cic	APN	7	25291204	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	25290950	missense	probably damaging	0.96
IGL02506:Cic	APN	7	25290857	missense	probably benign
IGL02794:Cic	APN	7	25285644	missense	probably damaging	1.00
IGL03065:Cic	APN	7	25285821	splice site	probably benign
IGL03304:Cic	APN	7	25284849	missense	probably damaging	1.00
Capuccino	UTSW	7	25287140	missense	probably damaging	0.98
Cassock	UTSW	7	25288913	nonsense	probably null
Monkey	UTSW	7	25287141	missense	probably damaging	1.00
R4850_Cic_466	UTSW	7	25272902	missense	probably damaging	0.98
1mM(1):Cic	UTSW	7	25290789	splice site	probably benign
IGL03046:Cic	UTSW	7	25291075	missense	probably damaging	1.00
R0012:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0012:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0027:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0027:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0038:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0038:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0063:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0063:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0064:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0118:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R0193:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0193:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0241:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0241:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0377:Cic	UTSW	7	25285799	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0800:Cic	UTSW	7	25285237	missense	probably benign
R1253:Cic	UTSW	7	25290948	missense	probably damaging	1.00
R1458:Cic	UTSW	7	25279737	intron	probably benign
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1519:Cic	UTSW	7	25293810	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	25285961	missense	probably damaging	1.00
R1824:Cic	UTSW	7	25288266	missense	probably damaging	1.00
R1908:Cic	UTSW	7	25286840	missense	probably damaging	1.00
R2045:Cic	UTSW	7	25271536	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	25273451	missense	probably damaging	0.98
R2161:Cic	UTSW	7	25288134	splice site	probably null
R2495:Cic	UTSW	7	25291776	splice site	probably benign
R2865:Cic	UTSW	7	25273221	missense	probably damaging	0.96
R3692:Cic	UTSW	7	25288913	nonsense	probably null
R3709:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3710:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3872:Cic	UTSW	7	25271699	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	25272346	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	25291670	frame shift	probably null
R4426:Cic	UTSW	7	25294008	utr 3 prime	probably benign
R4502:Cic	UTSW	7	25288467	missense	probably damaging	1.00
R4585:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4586:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4614:Cic	UTSW	7	25291670	frame shift	probably null
R4664:Cic	UTSW	7	25290674	small deletion	probably benign
R4688:Cic	UTSW	7	25291670	frame shift	probably null
R4695:Cic	UTSW	7	25273588	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	25288483	missense	probably benign
R4746:Cic	UTSW	7	25288480	missense	probably damaging	1.00
R4758:Cic	UTSW	7	25292211	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	25271600	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	25282883	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	25271732	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4851:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4922:Cic	UTSW	7	25291670	small insertion	probably benign
R4989:Cic	UTSW	7	25287110	missense	probably damaging	1.00
R5131:Cic	UTSW	7	25291670	small insertion	probably benign
R5718:Cic	UTSW	7	25272778	missense	probably benign	0.33
R5801:Cic	UTSW	7	25271438	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	25272305	missense	probably damaging	1.00
R6000:Cic	UTSW	7	25271998	missense	probably benign	0.33
R6246:Cic	UTSW	7	25271642	missense	probably damaging	1.00
R6283:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R6364:Cic	UTSW	7	25272823	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	25288281	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	25271777	missense	probably benign	0.04
R6920:Cic	UTSW	7	25290682	missense	probably damaging	1.00
R6995:Cic	UTSW	7	25271311	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	25272196	missense	probably damaging	0.99
R7113:Cic	UTSW	7	25273444	missense	probably benign	0.08
R7560:Cic	UTSW	7	25272853	missense	probably damaging	0.98
R7680:Cic	UTSW	7	25292431	missense	probably damaging	0.96
R7698:Cic	UTSW	7	25273172	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	25288782	missense	probably damaging	1.00
R7841:Cic	UTSW	7	25285767	missense	probably damaging	1.00
R7879:Cic	UTSW	7	25285126	missense	probably benign	0.10
R7916:Cic	UTSW	7	25288290	missense	probably damaging	0.99
R7920:Cic	UTSW	7	25271959	missense	probably benign
R8056:Cic	UTSW	7	25290941	missense	possibly damaging	0.90
R8226:Cic	UTSW	7	25287788	missense	probably damaging	1.00
R8281:Cic	UTSW	7	25271824	missense	probably benign
R8847:Cic	UTSW	7	25271206	missense	probably damaging	0.98
R8991:Cic	UTSW	7	25289460	missense	probably damaging	1.00
R9083:Cic	UTSW	7	25286045	missense	probably damaging	0.99
R9140:Cic	UTSW	7	25285740	missense	probably damaging	0.99
R9200:Cic	UTSW	7	25272515	missense	probably damaging	0.99
R9208:Cic	UTSW	7	25288077	missense	probably benign	0.07
R9301:Cic	UTSW	7	25291692	missense	probably damaging	1.00
R9408:Cic	UTSW	7	25271989	missense	possibly damaging	0.70
R9569:Cic	UTSW	7	25272695	missense	possibly damaging	0.85
R9752:Cic	UTSW	7	25271978	missense	probably damaging	0.96
V7732:Cic	UTSW	7	25292245	missense	probably benign
Z1176:Cic	UTSW	7	25271019	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TCTTGATGGTGGGGAAGTAGACAGC -3'
(R):5'- ACCTGAAGCCGTACACTAGGAAGAG -3'

Sequencing Primer
(F):5'- GTAGACAGCCAAGCACTTCAAG -3'
(R):5'- TCCGTGGCTGAAGTATATCCAAC -3'

Posted On

2013-05-09