Incidental Mutation 'R4585:Cuzd1'
ID344017
Institutional Source Beutler Lab
Gene Symbol Cuzd1
Ensembl Gene ENSMUSG00000040205
Gene NameCUB and zona pellucida-like domains 1
SynonymsERG-1, UTCZP, UO-44, Itmap1
MMRRC Submission 041806-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4585 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131308554-131322292 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131314800 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 310 (P310L)
Ref Sequence ENSEMBL: ENSMUSP00000037168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046611] [ENSMUST00000124096]
Predicted Effect probably damaging
Transcript: ENSMUST00000046611
AA Change: P310L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037168
Gene: ENSMUSG00000040205
AA Change: P310L

DomainStartEndE-ValueType
CUB 32 146 1.78e-16 SMART
CUB 154 265 1.1e-44 SMART
ZP 276 519 1.39e-63 SMART
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Meta Mutation Damage Score 0.5872 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (90/91)
MGI Phenotype PHENOTYPE: Female mice homozygous for disruption of this gene exhibit impaired mammary gland development during puberty and during and following pregnancy and do not lactate. Homozygous mutant mice show an increased susceptibility to induced pancreatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Akr7a5 G T 4: 139,310,927 R58L probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Aurkaip1 C A 4: 155,832,634 A113D possibly damaging Het
Bsn T C 9: 108,110,463 probably benign Het
Ccdc175 T G 12: 72,175,179 D123A possibly damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Ccnt2 T C 1: 127,803,029 S548P probably damaging Het
Cep126 T C 9: 8,103,337 Q224R probably damaging Het
Cic A T 7: 25,272,778 I645L probably benign Het
Cngb1 C T 8: 95,297,128 probably null Het
Col13a1 T C 10: 61,887,245 probably null Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Crebrf A G 17: 26,762,255 K535R probably damaging Het
Cxcr5 T A 9: 44,514,145 I72F probably benign Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dlgap2 G A 8: 14,727,999 probably null Het
Dnah8 A G 17: 30,751,567 D2684G probably benign Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 G A 18: 6,441,157 Q14* probably null Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Ercc5 G A 1: 44,158,857 V145I probably benign Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Glra3 C A 8: 56,088,993 T257K probably damaging Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm19965 T A 1: 116,821,778 N396K probably benign Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gmcl1 A G 6: 86,722,623 S141P probably damaging Het
Gsdmd T A 15: 75,865,751 probably null Het
Gtf2a1 C T 12: 91,562,926 V338I possibly damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Lctl T C 9: 64,131,600 S324P probably damaging Het
Lrrc24 C A 15: 76,723,689 R43L probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mroh5 T A 15: 73,789,271 T467S probably benign Het
Mtap G A 4: 89,172,274 V194I probably benign Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pabpc6 A G 17: 9,669,073 L183P probably damaging Het
Pcdh15 C T 10: 74,624,284 R1355W probably damaging Het
Pcdhgb8 C A 18: 37,762,360 A161E probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Phc2 A T 4: 128,743,510 H563L probably damaging Het
Plekha2 C A 8: 25,043,669 E291* probably null Het
Qser1 C A 2: 104,786,793 V1225L probably benign Het
Ralgapa2 A T 2: 146,315,024 D1882E probably damaging Het
Rgs17 T C 10: 5,842,596 D70G probably benign Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Scn2a T A 2: 65,743,051 probably null Het
Serpinb10 T A 1: 107,547,049 C314S probably benign Het
Setbp1 A C 18: 79,086,949 S23A probably benign Het
Sh3pxd2b A G 11: 32,396,479 D116G possibly damaging Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx19 T C 9: 30,440,195 L155P probably damaging Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Strn3 T A 12: 51,650,170 E259D probably benign Het
Tenm1 G A X: 42,537,979 Q1931* probably null Het
Trp53bp1 C G 2: 121,207,951 G1469R probably damaging Het
Ttc8 C A 12: 98,982,530 Q492K probably benign Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Utrn T A 10: 12,688,306 H1270L probably benign Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdfy4 T A 14: 33,087,955 I1770F possibly damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Other mutations in Cuzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cuzd1 APN 7 131316136 missense probably damaging 0.99
IGL01140:Cuzd1 APN 7 131311794 missense probably damaging 1.00
IGL01773:Cuzd1 APN 7 131314885 missense probably damaging 1.00
IGL02960:Cuzd1 APN 7 131320103 missense probably benign 0.01
PIT4504001:Cuzd1 UTSW 7 131309800 missense possibly damaging 0.88
R0233:Cuzd1 UTSW 7 131311816 missense possibly damaging 0.61
R0233:Cuzd1 UTSW 7 131311816 missense possibly damaging 0.61
R0363:Cuzd1 UTSW 7 131316262 missense probably benign 0.16
R0375:Cuzd1 UTSW 7 131311908 intron probably benign
R0446:Cuzd1 UTSW 7 131316280 splice site probably null
R0482:Cuzd1 UTSW 7 131309872 unclassified probably benign
R0765:Cuzd1 UTSW 7 131316095 missense probably benign 0.40
R0932:Cuzd1 UTSW 7 131320194 intron probably benign
R1463:Cuzd1 UTSW 7 131316642 missense probably damaging 1.00
R1533:Cuzd1 UTSW 7 131311703 missense probably damaging 0.99
R1722:Cuzd1 UTSW 7 131311644 missense probably damaging 0.96
R1920:Cuzd1 UTSW 7 131309696 missense probably benign 0.00
R2027:Cuzd1 UTSW 7 131320091 missense possibly damaging 0.93
R2039:Cuzd1 UTSW 7 131309616 missense probably benign 0.00
R2039:Cuzd1 UTSW 7 131314914 intron probably benign
R2857:Cuzd1 UTSW 7 131316134 missense probably damaging 0.97
R2859:Cuzd1 UTSW 7 131316134 missense probably damaging 0.97
R4586:Cuzd1 UTSW 7 131314800 missense probably damaging 1.00
R4830:Cuzd1 UTSW 7 131318054 missense probably damaging 0.99
R4945:Cuzd1 UTSW 7 131316621 missense probably damaging 1.00
R5009:Cuzd1 UTSW 7 131311523 missense probably damaging 1.00
R5337:Cuzd1 UTSW 7 131316074 missense probably damaging 1.00
R5355:Cuzd1 UTSW 7 131316124 missense probably damaging 1.00
R6543:Cuzd1 UTSW 7 131309768 missense probably damaging 1.00
R6569:Cuzd1 UTSW 7 131311757 missense probably damaging 1.00
R6681:Cuzd1 UTSW 7 131311683 missense probably damaging 1.00
R6818:Cuzd1 UTSW 7 131316665 missense probably damaging 1.00
R6819:Cuzd1 UTSW 7 131309731 missense possibly damaging 0.51
R7031:Cuzd1 UTSW 7 131308851 missense probably benign 0.22
R7524:Cuzd1 UTSW 7 131311618 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGCCTTCGTGTGTGAGTGAAC -3'
(R):5'- AAATGCAAAGTTCCTAGCTGGCC -3'

Sequencing Primer
(F):5'- CGTGTGTGAGTGAACATGTACAC -3'
(R):5'- TAGCTGGCCCAAATGTGATC -3'
Posted On2015-09-24