Incidental Mutation 'R0064:Arhgef17'
ID34402
Institutional Source Beutler Lab
Gene Symbol Arhgef17
Ensembl Gene ENSMUSG00000032875
Gene NameRho guanine nucleotide exchange factor (GEF) 17
Synonyms
MMRRC Submission 038356-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0064 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100869752-100932107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100881354 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1408 (M1408I)
Ref Sequence ENSEMBL: ENSMUSP00000102647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107032] [ENSMUST00000209041]
Predicted Effect probably benign
Transcript: ENSMUST00000107032
AA Change: M1408I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102647
Gene: ENSMUSG00000032875
AA Change: M1408I

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
low complexity region 160 175 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 227 255 N/A INTRINSIC
low complexity region 282 297 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 507 526 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
RhoGEF 1063 1246 9.56e-61 SMART
Blast:PH 1281 1466 4e-88 BLAST
low complexity region 1582 1595 N/A INTRINSIC
low complexity region 1630 1642 N/A INTRINSIC
low complexity region 1646 1657 N/A INTRINSIC
low complexity region 1661 1701 N/A INTRINSIC
low complexity region 1708 1719 N/A INTRINSIC
low complexity region 2033 2040 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175555
Predicted Effect probably benign
Transcript: ENSMUST00000208482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208735
Predicted Effect probably benign
Transcript: ENSMUST00000209041
AA Change: M399I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.256 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Arhgef17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Arhgef17 APN 7 100929449 missense probably benign
IGL01071:Arhgef17 APN 7 100885700 missense probably damaging 0.99
IGL01882:Arhgef17 APN 7 100878580 nonsense probably null
IGL01995:Arhgef17 APN 7 100928655 missense probably benign 0.02
IGL02213:Arhgef17 APN 7 100890426 missense probably benign
IGL02380:Arhgef17 APN 7 100929443 missense possibly damaging 0.60
IGL02551:Arhgef17 APN 7 100930346 missense probably damaging 1.00
IGL02613:Arhgef17 APN 7 100928896 missense probably damaging 1.00
IGL02643:Arhgef17 APN 7 100883882 missense possibly damaging 0.95
IGL02798:Arhgef17 APN 7 100929626 missense probably benign 0.00
IGL03113:Arhgef17 APN 7 100929731 missense probably benign 0.00
IGL03264:Arhgef17 APN 7 100880013 missense probably benign 0.00
R0189:Arhgef17 UTSW 7 100928850 missense probably damaging 1.00
R0482:Arhgef17 UTSW 7 100880621 missense probably damaging 1.00
R0826:Arhgef17 UTSW 7 100930743 missense probably benign 0.01
R1295:Arhgef17 UTSW 7 100881269 nonsense probably null
R1296:Arhgef17 UTSW 7 100881269 nonsense probably null
R1389:Arhgef17 UTSW 7 100931037 small deletion probably benign
R1466:Arhgef17 UTSW 7 100929659 missense possibly damaging 0.48
R1466:Arhgef17 UTSW 7 100929659 missense possibly damaging 0.48
R1513:Arhgef17 UTSW 7 100930862 missense probably benign
R1539:Arhgef17 UTSW 7 100890473 missense probably damaging 1.00
R1644:Arhgef17 UTSW 7 100929504 missense probably damaging 1.00
R1789:Arhgef17 UTSW 7 100929870 missense probably damaging 1.00
R1861:Arhgef17 UTSW 7 100882268 missense probably damaging 1.00
R1868:Arhgef17 UTSW 7 100878977 missense probably benign
R2009:Arhgef17 UTSW 7 100881781 missense probably damaging 0.98
R2095:Arhgef17 UTSW 7 100881263 missense probably damaging 1.00
R2311:Arhgef17 UTSW 7 100928904 missense probably benign 0.35
R3607:Arhgef17 UTSW 7 100931172 missense probably damaging 1.00
R3882:Arhgef17 UTSW 7 100876454 missense possibly damaging 0.70
R4089:Arhgef17 UTSW 7 100883799 missense probably damaging 1.00
R4420:Arhgef17 UTSW 7 100882308 splice site probably benign
R4536:Arhgef17 UTSW 7 100929854 missense probably damaging 1.00
R4548:Arhgef17 UTSW 7 100931129 missense possibly damaging 0.60
R4616:Arhgef17 UTSW 7 100882485 missense probably damaging 1.00
R5040:Arhgef17 UTSW 7 100876825 missense probably benign 0.17
R5100:Arhgef17 UTSW 7 100881756 missense possibly damaging 0.90
R5233:Arhgef17 UTSW 7 100881369 missense possibly damaging 0.61
R5307:Arhgef17 UTSW 7 100929428 missense probably benign 0.00
R5313:Arhgef17 UTSW 7 100928924 missense probably damaging 0.99
R5643:Arhgef17 UTSW 7 100880011 missense probably damaging 1.00
R5704:Arhgef17 UTSW 7 100881341 missense probably damaging 1.00
R6166:Arhgef17 UTSW 7 100876492 missense probably damaging 1.00
R6417:Arhgef17 UTSW 7 100930062 missense probably damaging 1.00
R6420:Arhgef17 UTSW 7 100930062 missense probably damaging 1.00
R6510:Arhgef17 UTSW 7 100878536 missense probably damaging 0.97
R6877:Arhgef17 UTSW 7 100881341 missense probably damaging 1.00
R6888:Arhgef17 UTSW 7 100930820 missense possibly damaging 0.74
R7016:Arhgef17 UTSW 7 100878977 missense probably benign
R7073:Arhgef17 UTSW 7 100929991 nonsense probably null
R7322:Arhgef17 UTSW 7 100877797 missense probably benign 0.01
X0012:Arhgef17 UTSW 7 100928904 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ATGAACTCTGGCTCACCCAGCTTC -3'
(R):5'- GGGACAGACAGTCTTGGCTTTTGC -3'

Sequencing Primer
(F):5'- CCTCTTGGCCTCATCAAAGG -3'
(R):5'- TTGCTCCCACTTAAGGGAAG -3'
Posted On2013-05-09