Mutagenetix > Incidental Mutation

Incidental Mutation 'R0064:Arhgef17'

34402

Institutional Source

Beutler Lab

Gene Symbol

Arhgef17

Ensembl Gene

ENSMUSG00000032875

Gene Name

Rho guanine nucleotide exchange factor (GEF) 17

Synonyms

MMRRC Submission

038356-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100869752-100932107 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 100881354 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 1408 (M1408I)

Ref Sequence

ENSEMBL: ENSMUSP00000102647 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107032] [ENSMUST00000209041]

AlphaFold

Q80U35

Predicted Effect

probably benign
Transcript: ENSMUST00000107032
AA Change: M1408I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000102647
Gene: ENSMUSG00000032875
AA Change: M1408I

Domain	Start	End	E-Value	Type
low complexity region	65	74	N/A	INTRINSIC
low complexity region	160	175	N/A	INTRINSIC
low complexity region	196	209	N/A	INTRINSIC
low complexity region	227	255	N/A	INTRINSIC
low complexity region	282	297	N/A	INTRINSIC
low complexity region	314	323	N/A	INTRINSIC
low complexity region	507	526	N/A	INTRINSIC
low complexity region	559	572	N/A	INTRINSIC
low complexity region	828	842	N/A	INTRINSIC
low complexity region	970	984	N/A	INTRINSIC
RhoGEF	1063	1246	9.56e-61	SMART
Blast:PH	1281	1466	4e-88	BLAST
low complexity region	1582	1595	N/A	INTRINSIC
low complexity region	1630	1642	N/A	INTRINSIC
low complexity region	1646	1657	N/A	INTRINSIC
low complexity region	1661	1701	N/A	INTRINSIC
low complexity region	1708	1719	N/A	INTRINSIC
low complexity region	2033	2040	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175555

Predicted Effect

probably benign
Transcript: ENSMUST00000208482

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208735

Predicted Effect

probably benign
Transcript: ENSMUST00000209041
AA Change: M399I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0597

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	C	11: 110,144,871	L641R	probably damaging	Het
Abca9	G	T	11: 110,144,872	L641M	probably damaging	Het
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cdon	A	G	9: 35,489,227	H1079R	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nlrc3	G	T	16: 3,964,087	T486K	possibly damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Plce1	T	C	19: 38,780,784		probably null	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Thbs1	A	T	2: 118,123,914		probably null	Het
Tie1	A	G	4: 118,489,701	V2A	possibly damaging	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Vmn2r111	T	A	17: 22,572,072	I82L	probably benign	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Arhgef17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Arhgef17	APN	7	100929449	missense	probably benign
IGL01071:Arhgef17	APN	7	100885700	missense	probably damaging	0.99
IGL01882:Arhgef17	APN	7	100878580	nonsense	probably null
IGL01995:Arhgef17	APN	7	100928655	missense	probably benign	0.02
IGL02213:Arhgef17	APN	7	100890426	missense	probably benign
IGL02380:Arhgef17	APN	7	100929443	missense	possibly damaging	0.60
IGL02551:Arhgef17	APN	7	100930346	missense	probably damaging	1.00
IGL02613:Arhgef17	APN	7	100928896	missense	probably damaging	1.00
IGL02643:Arhgef17	APN	7	100883882	missense	possibly damaging	0.95
IGL02798:Arhgef17	APN	7	100929626	missense	probably benign	0.00
IGL03113:Arhgef17	APN	7	100929731	missense	probably benign	0.00
IGL03264:Arhgef17	APN	7	100880013	missense	probably benign	0.00
G1Funyon:Arhgef17	UTSW	7	100879659	missense	probably benign	0.00
R0189:Arhgef17	UTSW	7	100928850	missense	probably damaging	1.00
R0482:Arhgef17	UTSW	7	100880621	missense	probably damaging	1.00
R0826:Arhgef17	UTSW	7	100930743	missense	probably benign	0.01
R1295:Arhgef17	UTSW	7	100881269	nonsense	probably null
R1296:Arhgef17	UTSW	7	100881269	nonsense	probably null
R1389:Arhgef17	UTSW	7	100931037	small deletion	probably benign
R1466:Arhgef17	UTSW	7	100929659	missense	possibly damaging	0.48
R1466:Arhgef17	UTSW	7	100929659	missense	possibly damaging	0.48
R1513:Arhgef17	UTSW	7	100930862	missense	probably benign
R1539:Arhgef17	UTSW	7	100890473	missense	probably damaging	1.00
R1644:Arhgef17	UTSW	7	100929504	missense	probably damaging	1.00
R1789:Arhgef17	UTSW	7	100929870	missense	probably damaging	1.00
R1861:Arhgef17	UTSW	7	100882268	missense	probably damaging	1.00
R1868:Arhgef17	UTSW	7	100878977	missense	probably benign
R2009:Arhgef17	UTSW	7	100881781	missense	probably damaging	0.98
R2095:Arhgef17	UTSW	7	100881263	missense	probably damaging	1.00
R2311:Arhgef17	UTSW	7	100928904	missense	probably benign	0.35
R3607:Arhgef17	UTSW	7	100931172	missense	probably damaging	1.00
R3882:Arhgef17	UTSW	7	100876454	missense	possibly damaging	0.70
R4089:Arhgef17	UTSW	7	100883799	missense	probably damaging	1.00
R4420:Arhgef17	UTSW	7	100882308	splice site	probably benign
R4536:Arhgef17	UTSW	7	100929854	missense	probably damaging	1.00
R4548:Arhgef17	UTSW	7	100931129	missense	possibly damaging	0.60
R4616:Arhgef17	UTSW	7	100882485	missense	probably damaging	1.00
R5040:Arhgef17	UTSW	7	100876825	missense	probably benign	0.17
R5100:Arhgef17	UTSW	7	100881756	missense	possibly damaging	0.90
R5233:Arhgef17	UTSW	7	100881369	missense	possibly damaging	0.61
R5307:Arhgef17	UTSW	7	100929428	missense	probably benign	0.00
R5313:Arhgef17	UTSW	7	100928924	missense	probably damaging	0.99
R5643:Arhgef17	UTSW	7	100880011	missense	probably damaging	1.00
R5704:Arhgef17	UTSW	7	100881341	missense	probably damaging	1.00
R6166:Arhgef17	UTSW	7	100876492	missense	probably damaging	1.00
R6417:Arhgef17	UTSW	7	100930062	missense	probably damaging	1.00
R6420:Arhgef17	UTSW	7	100930062	missense	probably damaging	1.00
R6510:Arhgef17	UTSW	7	100878536	missense	probably damaging	0.97
R6877:Arhgef17	UTSW	7	100881341	missense	probably damaging	1.00
R6888:Arhgef17	UTSW	7	100930820	missense	possibly damaging	0.74
R7016:Arhgef17	UTSW	7	100878977	missense	probably benign
R7073:Arhgef17	UTSW	7	100929991	nonsense	probably null
R7322:Arhgef17	UTSW	7	100877797	missense	probably benign	0.01
R7691:Arhgef17	UTSW	7	100929642	missense	probably damaging	1.00
R7724:Arhgef17	UTSW	7	100880609	missense	probably damaging	1.00
R7728:Arhgef17	UTSW	7	100930068	missense	probably benign	0.00
R7829:Arhgef17	UTSW	7	100876845	missense	probably benign	0.03
R8036:Arhgef17	UTSW	7	100929855	missense	probably damaging	1.00
R8072:Arhgef17	UTSW	7	100881797	missense	probably benign	0.04
R8301:Arhgef17	UTSW	7	100879659	missense	probably benign	0.00
R8935:Arhgef17	UTSW	7	100878117	missense	probably benign	0.03
R8958:Arhgef17	UTSW	7	100929812	missense	probably damaging	0.98
R9221:Arhgef17	UTSW	7	100879611	missense	possibly damaging	0.78
R9362:Arhgef17	UTSW	7	100930958	missense	probably benign	0.12
R9499:Arhgef17	UTSW	7	100876895	missense	possibly damaging	0.52
R9593:Arhgef17	UTSW	7	100882802	missense	probably damaging	1.00
X0012:Arhgef17	UTSW	7	100928904	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- ATGAACTCTGGCTCACCCAGCTTC -3'
(R):5'- GGGACAGACAGTCTTGGCTTTTGC -3'

Sequencing Primer
(F):5'- CCTCTTGGCCTCATCAAAGG -3'
(R):5'- TTGCTCCCACTTAAGGGAAG -3'

Posted On

2013-05-09