Incidental Mutation 'R4585:Itgb4'
ID 344043
Institutional Source Beutler Lab
Gene Symbol Itgb4
Ensembl Gene ENSMUSG00000020758
Gene Name integrin beta 4
Synonyms CD104
MMRRC Submission 041806-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4585 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 115974709-116008412 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115993325 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 945 (V945A)
Ref Sequence ENSEMBL: ENSMUSP00000127604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021107] [ENSMUST00000068981] [ENSMUST00000106458] [ENSMUST00000106460] [ENSMUST00000106461] [ENSMUST00000169928]
AlphaFold A2A863
Predicted Effect probably damaging
Transcript: ENSMUST00000021107
AA Change: V945A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021107
Gene: ENSMUSG00000020758
AA Change: V945A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068981
AA Change: V946A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070811
Gene: ENSMUSG00000020758
AA Change: V946A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1459 1540 1.79e-12 SMART
FN3 1572 1656 1.7e-13 SMART
low complexity region 1689 1702 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106458
AA Change: V946A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102066
Gene: ENSMUSG00000020758
AA Change: V946A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106460
AA Change: V946A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102068
Gene: ENSMUSG00000020758
AA Change: V946A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1512 1593 1.79e-12 SMART
FN3 1625 1709 1.7e-13 SMART
low complexity region 1742 1755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106461
AA Change: V946A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102069
Gene: ENSMUSG00000020758
AA Change: V946A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151691
Predicted Effect probably damaging
Transcript: ENSMUST00000169928
AA Change: V945A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127604
Gene: ENSMUSG00000020758
AA Change: V945A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180782
Meta Mutation Damage Score 0.5108 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: Integrins are heterodimers comprised of alpha and beta subunits, that are noncovalently associated transmembrane glycoprotein receptors. Different combinations of alpha and beta polypeptides form complexes that vary in their ligand-binding specificities. Integrins mediate cell-matrix or cell-cell adhesion, and transduced signals that regulate gene expression and cell growth. This gene encodes the integrin beta 4 subunit, a receptor for the laminins. This subunit tends to associate with alpha 6 subunit and is likely to play a pivotal role in the biology of invasive carcinoma. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die shortly after birth with extensive detachment of the epidermis and other squamus epithelia. Stratified tissues lack hemidesmosomes and simple epithelia are also defective in adherence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Akr7a5 G T 4: 139,310,927 R58L probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Aurkaip1 C A 4: 155,832,634 A113D possibly damaging Het
Bsn T C 9: 108,110,463 probably benign Het
Ccdc175 T G 12: 72,175,179 D123A possibly damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Ccnt2 T C 1: 127,803,029 S548P probably damaging Het
Cep126 T C 9: 8,103,337 Q224R probably damaging Het
Cic A T 7: 25,272,778 I645L probably benign Het
Cngb1 C T 8: 95,297,128 probably null Het
Col13a1 T C 10: 61,887,245 probably null Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Crebrf A G 17: 26,762,255 K535R probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cxcr5 T A 9: 44,514,145 I72F probably benign Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dlgap2 G A 8: 14,727,999 probably null Het
Dnah8 A G 17: 30,751,567 D2684G probably benign Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 G A 18: 6,441,157 Q14* probably null Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Ercc5 G A 1: 44,158,857 V145I probably benign Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Glra3 C A 8: 56,088,993 T257K probably damaging Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm19965 T A 1: 116,821,778 N396K probably benign Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gmcl1 A G 6: 86,722,623 S141P probably damaging Het
Gsdmd T A 15: 75,865,751 probably null Het
Gtf2a1 C T 12: 91,562,926 V338I possibly damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Lctl T C 9: 64,131,600 S324P probably damaging Het
Lrrc24 C A 15: 76,723,689 R43L probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mroh5 T A 15: 73,789,271 T467S probably benign Het
Mtap G A 4: 89,172,274 V194I probably benign Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pabpc6 A G 17: 9,669,073 L183P probably damaging Het
Pcdh15 C T 10: 74,624,284 R1355W probably damaging Het
Pcdhgb8 C A 18: 37,762,360 A161E probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Phc2 A T 4: 128,743,510 H563L probably damaging Het
Plekha2 C A 8: 25,043,669 E291* probably null Het
Qser1 C A 2: 104,786,793 V1225L probably benign Het
Ralgapa2 A T 2: 146,315,024 D1882E probably damaging Het
Rgs17 T C 10: 5,842,596 D70G probably benign Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Scn2a T A 2: 65,743,051 probably null Het
Serpinb10 T A 1: 107,547,049 C314S probably benign Het
Setbp1 A C 18: 79,086,949 S23A probably benign Het
Sh3pxd2b A G 11: 32,396,479 D116G possibly damaging Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx19 T C 9: 30,440,195 L155P probably damaging Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Strn3 T A 12: 51,650,170 E259D probably benign Het
Tenm1 G A X: 42,537,979 Q1931* probably null Het
Trp53bp1 C G 2: 121,207,951 G1469R probably damaging Het
Ttc8 C A 12: 98,982,530 Q492K probably benign Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Utrn T A 10: 12,688,306 H1270L probably benign Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdfy4 T A 14: 33,087,955 I1770F possibly damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Other mutations in Itgb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Itgb4 APN 11 115990940 missense probably damaging 1.00
IGL01391:Itgb4 APN 11 115990920 missense probably damaging 1.00
IGL01431:Itgb4 APN 11 116006457 splice site probably benign
IGL01750:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01752:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01756:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01766:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01769:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02188:Itgb4 APN 11 116003387 missense probably benign 0.08
IGL02262:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02293:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02318:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02319:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02338:Itgb4 APN 11 116007969 missense probably damaging 1.00
IGL02734:Itgb4 APN 11 116005966 missense probably benign
IGL02879:Itgb4 APN 11 115994352 missense probably benign 0.05
IGL02889:Itgb4 APN 11 115988905 missense probably damaging 1.00
IGL03183:Itgb4 APN 11 115988724 missense probably damaging 1.00
IGL03054:Itgb4 UTSW 11 116000340 nonsense probably null
R0021:Itgb4 UTSW 11 115979627 missense possibly damaging 0.95
R0092:Itgb4 UTSW 11 115979124 missense probably damaging 1.00
R0305:Itgb4 UTSW 11 115979412 missense probably damaging 1.00
R0408:Itgb4 UTSW 11 116007602 missense probably damaging 0.99
R0465:Itgb4 UTSW 11 115979756 missense probably damaging 1.00
R0499:Itgb4 UTSW 11 115979695 missense probably benign 0.00
R0535:Itgb4 UTSW 11 115991009 missense possibly damaging 0.86
R0571:Itgb4 UTSW 11 115979768 missense possibly damaging 0.94
R0613:Itgb4 UTSW 11 115993342 missense probably damaging 0.98
R0838:Itgb4 UTSW 11 115998162 intron probably benign
R1381:Itgb4 UTSW 11 115994337 missense probably benign 0.00
R1451:Itgb4 UTSW 11 115990884 missense probably damaging 1.00
R1459:Itgb4 UTSW 11 115979111 missense probably benign 0.42
R1460:Itgb4 UTSW 11 115984164 missense probably damaging 0.96
R1473:Itgb4 UTSW 11 115984047 missense probably benign 0.01
R1484:Itgb4 UTSW 11 115999799 missense probably benign 0.01
R1593:Itgb4 UTSW 11 115980991 missense probably damaging 1.00
R1623:Itgb4 UTSW 11 115991316 nonsense probably null
R1633:Itgb4 UTSW 11 116007760 missense probably damaging 1.00
R1642:Itgb4 UTSW 11 116007357 missense probably damaging 1.00
R1669:Itgb4 UTSW 11 115991330 missense probably benign 0.07
R1713:Itgb4 UTSW 11 116003489 missense probably damaging 1.00
R1732:Itgb4 UTSW 11 115988918 missense probably damaging 1.00
R1791:Itgb4 UTSW 11 115988520 missense probably damaging 1.00
R1847:Itgb4 UTSW 11 115983764 missense probably benign 0.31
R1902:Itgb4 UTSW 11 115980738 missense probably damaging 0.98
R1945:Itgb4 UTSW 11 115993453 nonsense probably null
R2102:Itgb4 UTSW 11 116005735 missense probably benign 0.23
R2184:Itgb4 UTSW 11 115979624 missense probably damaging 0.96
R2334:Itgb4 UTSW 11 115993435 missense probably damaging 1.00
R2401:Itgb4 UTSW 11 116006563 missense possibly damaging 0.67
R3743:Itgb4 UTSW 11 116003670 missense probably damaging 1.00
R3938:Itgb4 UTSW 11 116005926 missense possibly damaging 0.92
R4134:Itgb4 UTSW 11 116006470 missense probably benign 0.03
R4280:Itgb4 UTSW 11 115990935 missense probably damaging 1.00
R4342:Itgb4 UTSW 11 115988729 missense probably benign 0.01
R4434:Itgb4 UTSW 11 115999814 missense probably benign 0.10
R4505:Itgb4 UTSW 11 115983261 splice site silent
R4586:Itgb4 UTSW 11 115993325 missense probably damaging 1.00
R4601:Itgb4 UTSW 11 116005722 missense probably damaging 1.00
R4921:Itgb4 UTSW 11 116006605 missense probably benign 0.12
R4962:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5027:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5029:Itgb4 UTSW 11 115988591 intron probably benign
R5084:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5085:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5124:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5125:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5150:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5175:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5176:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5179:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5207:Itgb4 UTSW 11 116006539 missense probably damaging 1.00
R5263:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5264:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5334:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5337:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5344:Itgb4 UTSW 11 115989749 missense probably null 0.92
R5391:Itgb4 UTSW 11 115985068 missense probably benign 0.05
R5437:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5440:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5653:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5654:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5655:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5772:Itgb4 UTSW 11 115988432 intron probably benign
R5812:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5813:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5814:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5863:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5864:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5865:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5951:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5954:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5982:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6043:Itgb4 UTSW 11 115979386 missense probably benign 0.30
R6133:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6134:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6135:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6169:Itgb4 UTSW 11 115994276 missense probably damaging 0.98
R6172:Itgb4 UTSW 11 116000411 missense probably benign 0.23
R6255:Itgb4 UTSW 11 115998137 missense possibly damaging 0.83
R6258:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6259:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6260:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6612:Itgb4 UTSW 11 115984071 missense probably benign 0.00
R7037:Itgb4 UTSW 11 116005565 nonsense probably null
R7371:Itgb4 UTSW 11 115998080 missense probably benign 0.29
R7605:Itgb4 UTSW 11 116006476 missense probably benign 0.01
R7659:Itgb4 UTSW 11 115979731 missense probably damaging 1.00
R7759:Itgb4 UTSW 11 116003710 missense possibly damaging 0.92
R7804:Itgb4 UTSW 11 116003684 missense probably damaging 1.00
R7832:Itgb4 UTSW 11 116000261 missense probably damaging 1.00
R7842:Itgb4 UTSW 11 115982705 missense probably benign 0.18
R7923:Itgb4 UTSW 11 115982699 critical splice acceptor site probably null
R8004:Itgb4 UTSW 11 115982705 missense probably benign 0.00
R8143:Itgb4 UTSW 11 115993429 missense probably damaging 1.00
R8427:Itgb4 UTSW 11 115991718 critical splice donor site probably null
R8857:Itgb4 UTSW 11 115981027 missense probably benign 0.04
R8863:Itgb4 UTSW 11 115985072 nonsense probably null
R8932:Itgb4 UTSW 11 115988469 missense probably benign 0.01
R9153:Itgb4 UTSW 11 115984053 missense probably benign 0.00
R9207:Itgb4 UTSW 11 116007097 missense probably damaging 1.00
R9239:Itgb4 UTSW 11 116007304 missense probably damaging 1.00
R9267:Itgb4 UTSW 11 115979639 missense probably benign
R9289:Itgb4 UTSW 11 115994361 missense probably benign 0.01
R9328:Itgb4 UTSW 11 115989799 missense probably benign 0.00
R9435:Itgb4 UTSW 11 116005029 missense probably benign 0.01
R9450:Itgb4 UTSW 11 115983271 missense probably damaging 1.00
R9649:Itgb4 UTSW 11 115994345 missense possibly damaging 0.78
R9779:Itgb4 UTSW 11 115991659 missense probably damaging 1.00
X0062:Itgb4 UTSW 11 115993452 missense probably damaging 1.00
Z1176:Itgb4 UTSW 11 116006520 missense probably damaging 1.00
Z1177:Itgb4 UTSW 11 115986811 missense probably damaging 0.99
Z1177:Itgb4 UTSW 11 115998058 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCTGAAGCTGACAGAGAAGC -3'
(R):5'- CAGGATATCTGGAGGATCACG -3'

Sequencing Primer
(F):5'- CAGGGGTCCTTCCATGAACTGAAG -3'
(R):5'- TATCTGGAGGATCACGGAGCC -3'
Posted On 2015-09-24