Incidental Mutation 'R4585:Tenm1'
ID344062
Institutional Source Beutler Lab
Gene Symbol Tenm1
Ensembl Gene ENSMUSG00000016150
Gene Nameteneurin transmembrane protein 1
SynonymsTCAP-1, teneurin-1, Odz1, Ten-m1
MMRRC Submission 041806-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R4585 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location42527866-43429126 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 42537979 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 1931 (Q1931*)
Ref Sequence ENSEMBL: ENSMUSP00000110711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016294] [ENSMUST00000115058] [ENSMUST00000115059]
Predicted Effect probably null
Transcript: ENSMUST00000016294
AA Change: Q1931*
SMART Domains Protein: ENSMUSP00000016294
Gene: ENSMUSG00000016150
AA Change: Q1931*

DomainStartEndE-ValueType
Pfam:Ten_N 12 177 5.1e-30 PFAM
Pfam:Ten_N 168 317 1.5e-45 PFAM
transmembrane domain 318 340 N/A INTRINSIC
EGF 530 558 8.8e-3 SMART
EGF_like 561 589 2.5e-1 SMART
EGF 594 623 1.2e-2 SMART
EGF 626 655 4.5e-3 SMART
EGF 660 690 1.1e-1 SMART
EGF 693 721 6e-2 SMART
EGF 724 752 1.5e-2 SMART
EGF 763 795 1.6e-2 SMART
low complexity region 801 816 N/A INTRINSIC
Pfam:Tox-GHH 2647 2724 5e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115058
AA Change: Q1924*
SMART Domains Protein: ENSMUSP00000110710
Gene: ENSMUSG00000016150
AA Change: Q1924*

DomainStartEndE-ValueType
Pfam:Ten_N 11 170 5.4e-36 PFAM
Pfam:Ten_N 159 317 7.4e-46 PFAM
transmembrane domain 318 340 N/A INTRINSIC
EGF 530 558 1.73e0 SMART
EGF_like 561 589 5.13e1 SMART
EGF 594 623 2.45e0 SMART
EGF 626 655 9.27e-1 SMART
EGF 660 690 2.29e1 SMART
EGF 693 721 1.2e1 SMART
EGF 724 752 3.01e0 SMART
EGF 763 795 3.23e0 SMART
low complexity region 801 816 N/A INTRINSIC
Pfam:Tox-GHH 2639 2717 1.1e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115059
AA Change: Q1931*
SMART Domains Protein: ENSMUSP00000110711
Gene: ENSMUSG00000016150
AA Change: Q1931*

DomainStartEndE-ValueType
Pfam:Ten_N 11 170 1.2e-32 PFAM
Pfam:Ten_N 159 317 1.6e-42 PFAM
transmembrane domain 318 340 N/A INTRINSIC
EGF 530 558 8.6e-3 SMART
EGF_like 561 589 2.5e-1 SMART
EGF 594 623 1.2e-2 SMART
EGF 626 655 4.4e-3 SMART
EGF 660 690 1.1e-1 SMART
EGF 693 721 5.8e-2 SMART
EGF 724 752 1.5e-2 SMART
EGF 763 795 1.6e-2 SMART
low complexity region 801 816 N/A INTRINSIC
Pfam:Tox-GHH 2646 2724 2.3e-30 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tenascin family and teneurin subfamily. It is expressed in the neurons and may function as a cellular signal transducer. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Akr7a5 G T 4: 139,310,927 R58L probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Aurkaip1 C A 4: 155,832,634 A113D possibly damaging Het
Bsn T C 9: 108,110,463 probably benign Het
Ccdc175 T G 12: 72,175,179 D123A possibly damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Ccnt2 T C 1: 127,803,029 S548P probably damaging Het
Cep126 T C 9: 8,103,337 Q224R probably damaging Het
Cic A T 7: 25,272,778 I645L probably benign Het
Cngb1 C T 8: 95,297,128 probably null Het
Col13a1 T C 10: 61,887,245 probably null Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Crebrf A G 17: 26,762,255 K535R probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cxcr5 T A 9: 44,514,145 I72F probably benign Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dlgap2 G A 8: 14,727,999 probably null Het
Dnah8 A G 17: 30,751,567 D2684G probably benign Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 G A 18: 6,441,157 Q14* probably null Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Ercc5 G A 1: 44,158,857 V145I probably benign Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Glra3 C A 8: 56,088,993 T257K probably damaging Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm19965 T A 1: 116,821,778 N396K probably benign Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gmcl1 A G 6: 86,722,623 S141P probably damaging Het
Gsdmd T A 15: 75,865,751 probably null Het
Gtf2a1 C T 12: 91,562,926 V338I possibly damaging Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Lctl T C 9: 64,131,600 S324P probably damaging Het
Lrrc24 C A 15: 76,723,689 R43L probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mroh5 T A 15: 73,789,271 T467S probably benign Het
Mtap G A 4: 89,172,274 V194I probably benign Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pabpc6 A G 17: 9,669,073 L183P probably damaging Het
Pcdh15 C T 10: 74,624,284 R1355W probably damaging Het
Pcdhgb8 C A 18: 37,762,360 A161E probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Phc2 A T 4: 128,743,510 H563L probably damaging Het
Plekha2 C A 8: 25,043,669 E291* probably null Het
Qser1 C A 2: 104,786,793 V1225L probably benign Het
Ralgapa2 A T 2: 146,315,024 D1882E probably damaging Het
Rgs17 T C 10: 5,842,596 D70G probably benign Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Scn2a T A 2: 65,743,051 probably null Het
Serpinb10 T A 1: 107,547,049 C314S probably benign Het
Setbp1 A C 18: 79,086,949 S23A probably benign Het
Sh3pxd2b A G 11: 32,396,479 D116G possibly damaging Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx19 T C 9: 30,440,195 L155P probably damaging Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Strn3 T A 12: 51,650,170 E259D probably benign Het
Trp53bp1 C G 2: 121,207,951 G1469R probably damaging Het
Ttc8 C A 12: 98,982,530 Q492K probably benign Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Utrn T A 10: 12,688,306 H1270L probably benign Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdfy4 T A 14: 33,087,955 I1770F possibly damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Other mutations in Tenm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Tenm1 APN X 42715036 missense probably benign 0.04
R0481:Tenm1 UTSW X 42536181 missense probably damaging 1.00
R1959:Tenm1 UTSW X 42827201 missense probably benign 0.06
R1960:Tenm1 UTSW X 42827201 missense probably benign 0.06
R3734:Tenm1 UTSW X 42684067 missense probably benign 0.32
R5704:Tenm1 UTSW X 43074695 missense possibly damaging 0.58
R5706:Tenm1 UTSW X 43074695 missense possibly damaging 0.58
R6112:Tenm1 UTSW X 42827195 missense probably damaging 1.00
R6113:Tenm1 UTSW X 42827195 missense probably damaging 1.00
X0067:Tenm1 UTSW X 42536862 missense probably damaging 1.00
Z1088:Tenm1 UTSW X 42899835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGACAGTCTTGCTTGC -3'
(R):5'- CTTTGCCTGCCCAAGATTATTTAG -3'

Sequencing Primer
(F):5'- CAGACAGTCTTGCTTGCTTTGTGTAC -3'
(R):5'- GTCCCTGGCACATAGTAATTGCTAG -3'
Posted On2015-09-24