Incidental Mutation 'R4586:Scn2a'
ID 344071
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Nav1.2, Scn2a1
MMRRC Submission 041807-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4586 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 65451115-65597791 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 65573395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably null
Transcript: ENSMUST00000028377
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100067
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000200829
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 4,026,151 (GRCm39) S1269P probably benign Het
Aqr T C 2: 113,943,058 (GRCm39) T1172A probably benign Het
Art2a A T 7: 101,203,956 (GRCm39) L194* probably null Het
Atrn T C 2: 130,823,962 (GRCm39) F967S probably damaging Het
Btnl1 A G 17: 34,601,436 (GRCm39) D323G probably damaging Het
Cadps C A 14: 12,505,808 (GRCm38) C754F probably damaging Het
Catspere2 A G 1: 177,950,351 (GRCm39) D734G possibly damaging Het
Ccdc7b A G 8: 129,837,401 (GRCm39) T131A probably benign Het
Cfap298 A T 16: 90,724,314 (GRCm39) V136D probably damaging Het
Cic A T 7: 24,972,203 (GRCm39) I645L probably benign Het
Clca3a1 C A 3: 144,722,619 (GRCm39) C251F probably damaging Het
Cldn16 A T 16: 26,296,308 (GRCm39) T95S probably benign Het
Cntnap4 C T 8: 113,537,342 (GRCm39) H738Y probably benign Het
Col8a2 A T 4: 126,204,812 (GRCm39) probably benign Het
Corin A T 5: 72,487,042 (GRCm39) V706D probably damaging Het
Cuzd1 G A 7: 130,916,529 (GRCm39) P310L probably damaging Het
Cyp4a12a T C 4: 115,184,509 (GRCm39) F295L probably benign Het
Cyp4a12b T G 4: 115,289,703 (GRCm39) M190R probably damaging Het
Dagla A G 19: 10,248,373 (GRCm39) Y96H probably damaging Het
Dapp1 T C 3: 137,644,932 (GRCm39) Q148R probably benign Het
Dcaf17 T A 2: 70,918,924 (GRCm39) S499R probably benign Het
Ddx27 T A 2: 166,861,904 (GRCm39) D135E probably benign Het
Defb3 A T 8: 19,345,172 (GRCm39) I43F possibly damaging Het
Dnajc10 T G 2: 80,178,122 (GRCm39) F710V probably damaging Het
Dnhd1 T C 7: 105,327,256 (GRCm39) L735P probably damaging Het
Dnmt1 G A 9: 20,837,989 (GRCm39) P242S probably benign Het
Dync1h1 G A 12: 110,615,917 (GRCm39) D3022N probably benign Het
Ep400 G A 5: 110,901,725 (GRCm39) T464I probably damaging Het
Epc1 T C 18: 6,449,138 (GRCm39) N453S possibly damaging Het
Eral1 A T 11: 77,969,130 (GRCm39) N123K probably damaging Het
Ercc5 G A 1: 44,198,017 (GRCm39) V145I probably benign Het
Evc A G 5: 37,481,057 (GRCm39) S263P probably damaging Het
Fancc A T 13: 63,495,378 (GRCm39) M182K probably benign Het
Fbxl3 G T 14: 103,320,526 (GRCm39) A355E probably damaging Het
Fig4 A C 10: 41,064,628 (GRCm39) S872A probably damaging Het
Gm14393 C A 2: 174,904,497 (GRCm39) probably benign Het
Gm27013 A T 6: 130,498,003 (GRCm39) noncoding transcript Het
Gprc5a T A 6: 135,060,450 (GRCm39) M313K probably benign Het
H2ac15 T C 13: 21,937,882 (GRCm39) N39S possibly damaging Het
H2-T3 T C 17: 36,500,236 (GRCm39) probably null Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hook3 T G 8: 26,522,039 (GRCm39) K679T probably damaging Het
Ints2 G T 11: 86,140,101 (GRCm39) R244S probably damaging Het
Itgb4 T C 11: 115,884,151 (GRCm39) V945A probably damaging Het
Itih2 C T 2: 10,115,211 (GRCm39) S387N probably benign Het
Jmjd7 T A 2: 119,862,649 (GRCm39) M306K probably benign Het
Klra2 T A 6: 131,207,120 (GRCm39) D163V probably benign Het
Kmo T A 1: 175,478,138 (GRCm39) M208K probably damaging Het
Kmo G T 1: 175,478,139 (GRCm39) M208I possibly damaging Het
Masp2 A G 4: 148,698,358 (GRCm39) T480A probably damaging Het
Mogs G T 6: 83,095,619 (GRCm39) R812L possibly damaging Het
Mrpl43 A G 19: 44,994,328 (GRCm39) I97T possibly damaging Het
Myoz1 A G 14: 20,700,663 (GRCm39) W185R probably damaging Het
Ncam2 T A 16: 81,262,457 (GRCm39) H303Q probably benign Het
Ntaq1 A T 15: 58,011,740 (GRCm39) I34F probably damaging Het
Nufip2 T C 11: 77,632,554 (GRCm39) V690A unknown Het
Obox1 A T 7: 15,290,152 (GRCm39) N165I possibly damaging Het
Or1j1 C T 2: 36,702,537 (GRCm39) C189Y probably damaging Het
Or4b1d T A 2: 89,968,558 (GRCm39) E308D probably benign Het
Or4c113 T G 2: 88,885,498 (GRCm39) I91L possibly damaging Het
Or6c35 A G 10: 129,169,142 (GRCm39) T131A probably benign Het
Pex1 A G 5: 3,683,885 (GRCm39) Y1127C probably damaging Het
Pno1 T C 11: 17,161,438 (GRCm39) K24E probably benign Het
Qdpr T A 5: 45,596,669 (GRCm39) N165I possibly damaging Het
Robo2 A G 16: 73,758,761 (GRCm39) V674A probably damaging Het
Runx1t1 A T 4: 13,889,864 (GRCm39) T598S unknown Het
Samd11 A G 4: 156,333,889 (GRCm39) L174P probably damaging Het
Slc4a1 G T 11: 102,252,245 (GRCm39) probably benign Het
Snx25 A T 8: 46,569,474 (GRCm39) probably benign Het
Sox2 A G 3: 34,705,193 (GRCm39) N210S probably benign Het
Spag6 T C 2: 18,736,958 (GRCm39) probably null Het
Speer4b A T 5: 27,703,036 (GRCm39) L154Q probably null Het
Stt3a T A 9: 36,653,089 (GRCm39) Q531L probably damaging Het
Tcl1 A C 12: 105,183,767 (GRCm39) probably benign Het
Trip11 A T 12: 101,849,600 (GRCm39) M1488K possibly damaging Het
Ttn T C 2: 76,798,747 (GRCm39) H509R probably benign Het
Ulk3 C T 9: 57,501,593 (GRCm39) L425F possibly damaging Het
Vmn1r238 T A 18: 3,123,294 (GRCm39) K40M probably damaging Het
Vopp1 G A 6: 57,731,533 (GRCm39) P153S probably damaging Het
Zbtb42 C T 12: 112,646,976 (GRCm39) R384W probably damaging Het
Zfp14 G T 7: 29,738,341 (GRCm39) Q215K probably damaging Het
Zfp473 A T 7: 44,382,376 (GRCm39) Y651* probably null Het
Zfp735 G T 11: 73,580,550 (GRCm39) E16D possibly damaging Het
Zfp846 G T 9: 20,504,809 (GRCm39) C223F probably damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65,594,784 (GRCm39) missense probably benign
IGL00159:Scn2a APN 2 65,573,434 (GRCm39) missense probably damaging 1.00
IGL00418:Scn2a APN 2 65,594,866 (GRCm39) missense probably benign 0.43
IGL00753:Scn2a APN 2 65,514,207 (GRCm39) missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00774:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00847:Scn2a APN 2 65,501,078 (GRCm39) missense probably damaging 1.00
IGL01155:Scn2a APN 2 65,548,092 (GRCm39) missense probably damaging 1.00
IGL01329:Scn2a APN 2 65,547,852 (GRCm39) missense probably benign 0.05
IGL01537:Scn2a APN 2 65,546,219 (GRCm39) missense probably benign 0.00
IGL01672:Scn2a APN 2 65,582,278 (GRCm39) missense probably damaging 1.00
IGL01958:Scn2a APN 2 65,532,173 (GRCm39) missense probably damaging 1.00
IGL02028:Scn2a APN 2 65,594,002 (GRCm39) missense probably damaging 0.96
IGL02142:Scn2a APN 2 65,546,182 (GRCm39) missense probably damaging 1.00
IGL02160:Scn2a APN 2 65,560,460 (GRCm39) missense probably damaging 1.00
IGL02183:Scn2a APN 2 65,501,947 (GRCm39) missense probably benign 0.20
IGL02341:Scn2a APN 2 65,518,721 (GRCm39) missense probably damaging 1.00
IGL02504:Scn2a APN 2 65,514,228 (GRCm39) missense probably benign 0.02
IGL02530:Scn2a APN 2 65,560,522 (GRCm39) missense probably damaging 0.99
IGL02621:Scn2a APN 2 65,579,223 (GRCm39) splice site probably benign
IGL02652:Scn2a APN 2 65,532,382 (GRCm39) missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65,532,188 (GRCm39) missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65,501,997 (GRCm39) missense probably damaging 0.99
IGL03329:Scn2a APN 2 65,594,973 (GRCm39) missense probably benign
IGL03336:Scn2a APN 2 65,519,088 (GRCm39) missense probably damaging 1.00
IGL03391:Scn2a APN 2 65,594,557 (GRCm39) missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65,546,074 (GRCm39) missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65,514,182 (GRCm39) missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65,542,252 (GRCm39) missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65,518,763 (GRCm39) missense probably damaging 1.00
R0021:Scn2a UTSW 2 65,500,859 (GRCm39) missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65,542,160 (GRCm39) missense probably benign 0.01
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0335:Scn2a UTSW 2 65,512,435 (GRCm39) missense probably damaging 1.00
R0508:Scn2a UTSW 2 65,548,186 (GRCm39) missense probably damaging 0.99
R0558:Scn2a UTSW 2 65,542,269 (GRCm39) missense probably benign 0.26
R0600:Scn2a UTSW 2 65,532,177 (GRCm39) missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65,582,340 (GRCm39) missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65,517,123 (GRCm39) splice site probably benign
R1244:Scn2a UTSW 2 65,593,999 (GRCm39) missense probably damaging 0.98
R1386:Scn2a UTSW 2 65,519,085 (GRCm39) missense probably damaging 1.00
R1434:Scn2a UTSW 2 65,532,335 (GRCm39) missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65,594,938 (GRCm39) missense probably benign
R1448:Scn2a UTSW 2 65,514,189 (GRCm39) missense probably benign 0.17
R1460:Scn2a UTSW 2 65,532,187 (GRCm39) missense probably damaging 0.96
R1553:Scn2a UTSW 2 65,544,180 (GRCm39) nonsense probably null
R1642:Scn2a UTSW 2 65,514,041 (GRCm39) missense probably damaging 1.00
R1803:Scn2a UTSW 2 65,501,111 (GRCm39) splice site probably null
R1981:Scn2a UTSW 2 65,520,514 (GRCm39) missense probably damaging 1.00
R2002:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R2068:Scn2a UTSW 2 65,582,417 (GRCm39) missense probably benign 0.14
R2125:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2126:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2876:Scn2a UTSW 2 65,546,241 (GRCm39) missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65,518,715 (GRCm39) missense probably damaging 1.00
R3113:Scn2a UTSW 2 65,579,129 (GRCm39) missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3750:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3765:Scn2a UTSW 2 65,513,054 (GRCm39) missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65,512,375 (GRCm39) missense probably benign 0.14
R4585:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4588:Scn2a UTSW 2 65,544,111 (GRCm39) missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65,582,371 (GRCm39) missense probably benign 0.04
R5108:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R5161:Scn2a UTSW 2 65,594,935 (GRCm39) missense probably benign 0.00
R5235:Scn2a UTSW 2 65,582,355 (GRCm39) missense probably damaging 1.00
R5464:Scn2a UTSW 2 65,532,100 (GRCm39) missense probably damaging 1.00
R5586:Scn2a UTSW 2 65,537,639 (GRCm39) nonsense probably null
R5630:Scn2a UTSW 2 65,556,709 (GRCm39) missense probably damaging 1.00
R5715:Scn2a UTSW 2 65,547,928 (GRCm39) missense probably benign 0.27
R5730:Scn2a UTSW 2 65,512,882 (GRCm39) nonsense probably null
R5734:Scn2a UTSW 2 65,548,066 (GRCm39) missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65,594,827 (GRCm39) missense probably benign 0.00
R6133:Scn2a UTSW 2 65,573,448 (GRCm39) missense probably benign 0.35
R6547:Scn2a UTSW 2 65,546,241 (GRCm39) missense probably benign 0.29
R6549:Scn2a UTSW 2 65,595,018 (GRCm39) missense probably benign 0.05
R6818:Scn2a UTSW 2 65,519,013 (GRCm39) nonsense probably null
R6999:Scn2a UTSW 2 65,512,453 (GRCm39) missense probably benign
R7069:Scn2a UTSW 2 65,594,950 (GRCm39) missense probably benign 0.00
R7073:Scn2a UTSW 2 65,558,787 (GRCm39) missense probably benign 0.00
R7125:Scn2a UTSW 2 65,594,277 (GRCm39) missense probably damaging 1.00
R7178:Scn2a UTSW 2 65,579,197 (GRCm39) nonsense probably null
R7179:Scn2a UTSW 2 65,532,323 (GRCm39) missense probably damaging 1.00
R7203:Scn2a UTSW 2 65,578,663 (GRCm39) missense probably benign 0.01
R7227:Scn2a UTSW 2 65,582,367 (GRCm39) missense probably damaging 0.98
R7269:Scn2a UTSW 2 65,594,113 (GRCm39) missense probably damaging 1.00
R7358:Scn2a UTSW 2 65,512,850 (GRCm39) nonsense probably null
R7388:Scn2a UTSW 2 65,518,998 (GRCm39) missense probably damaging 1.00
R7491:Scn2a UTSW 2 65,532,352 (GRCm39) missense probably damaging 0.99
R7619:Scn2a UTSW 2 65,546,247 (GRCm39) missense probably damaging 1.00
R7695:Scn2a UTSW 2 65,542,251 (GRCm39) missense probably damaging 0.99
R7735:Scn2a UTSW 2 65,594,013 (GRCm39) missense probably benign 0.40
R7911:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R8096:Scn2a UTSW 2 65,594,366 (GRCm39) missense probably damaging 0.98
R8172:Scn2a UTSW 2 65,520,672 (GRCm39) missense probably benign 0.01
R8220:Scn2a UTSW 2 65,520,620 (GRCm39) missense probably benign 0.01
R8333:Scn2a UTSW 2 65,514,191 (GRCm39) missense probably benign 0.01
R8416:Scn2a UTSW 2 65,511,345 (GRCm39) missense probably benign 0.00
R8850:Scn2a UTSW 2 65,518,730 (GRCm39) missense probably damaging 1.00
R8897:Scn2a UTSW 2 65,546,002 (GRCm39) critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65,594,014 (GRCm39) missense probably damaging 0.99
R8992:Scn2a UTSW 2 65,594,242 (GRCm39) missense probably damaging 1.00
R9190:Scn2a UTSW 2 65,511,346 (GRCm39) missense probably benign 0.00
R9206:Scn2a UTSW 2 65,548,131 (GRCm39) missense probably damaging 1.00
R9355:Scn2a UTSW 2 65,594,433 (GRCm39) missense probably damaging 1.00
R9452:Scn2a UTSW 2 65,595,163 (GRCm39) missense probably benign
R9529:Scn2a UTSW 2 65,594,932 (GRCm39) missense probably damaging 0.99
R9567:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R9569:Scn2a UTSW 2 65,560,622 (GRCm39) missense probably damaging 1.00
R9657:Scn2a UTSW 2 65,566,032 (GRCm39) missense probably damaging 1.00
R9715:Scn2a UTSW 2 65,579,149 (GRCm39) missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65,566,030 (GRCm39) missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65,582,212 (GRCm39) missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65,548,079 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CACAAACGGACTTGAATGAATCTTGG -3'
(R):5'- GGTTCCTATTAGACCTTTTCACATG -3'

Sequencing Primer
(F):5'- GGGATTGTTGATACATGTACACACTG -3'
(R):5'- TCTTTAACTAAAGAAACGAATCCCC -3'
Posted On 2015-09-24