Incidental Mutation 'R4586:Atrn'
ID 344081
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission 041807-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4586 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 130748415-130872253 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130823962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 967 (F967S)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably damaging
Transcript: ENSMUST00000028781
AA Change: F967S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: F967S

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134964
Meta Mutation Damage Score 0.7167 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 4,026,151 (GRCm39) S1269P probably benign Het
Aqr T C 2: 113,943,058 (GRCm39) T1172A probably benign Het
Art2a A T 7: 101,203,956 (GRCm39) L194* probably null Het
Btnl1 A G 17: 34,601,436 (GRCm39) D323G probably damaging Het
Cadps C A 14: 12,505,808 (GRCm38) C754F probably damaging Het
Catspere2 A G 1: 177,950,351 (GRCm39) D734G possibly damaging Het
Ccdc7b A G 8: 129,837,401 (GRCm39) T131A probably benign Het
Cfap298 A T 16: 90,724,314 (GRCm39) V136D probably damaging Het
Cic A T 7: 24,972,203 (GRCm39) I645L probably benign Het
Clca3a1 C A 3: 144,722,619 (GRCm39) C251F probably damaging Het
Cldn16 A T 16: 26,296,308 (GRCm39) T95S probably benign Het
Cntnap4 C T 8: 113,537,342 (GRCm39) H738Y probably benign Het
Col8a2 A T 4: 126,204,812 (GRCm39) probably benign Het
Corin A T 5: 72,487,042 (GRCm39) V706D probably damaging Het
Cuzd1 G A 7: 130,916,529 (GRCm39) P310L probably damaging Het
Cyp4a12a T C 4: 115,184,509 (GRCm39) F295L probably benign Het
Cyp4a12b T G 4: 115,289,703 (GRCm39) M190R probably damaging Het
Dagla A G 19: 10,248,373 (GRCm39) Y96H probably damaging Het
Dapp1 T C 3: 137,644,932 (GRCm39) Q148R probably benign Het
Dcaf17 T A 2: 70,918,924 (GRCm39) S499R probably benign Het
Ddx27 T A 2: 166,861,904 (GRCm39) D135E probably benign Het
Defb3 A T 8: 19,345,172 (GRCm39) I43F possibly damaging Het
Dnajc10 T G 2: 80,178,122 (GRCm39) F710V probably damaging Het
Dnhd1 T C 7: 105,327,256 (GRCm39) L735P probably damaging Het
Dnmt1 G A 9: 20,837,989 (GRCm39) P242S probably benign Het
Dync1h1 G A 12: 110,615,917 (GRCm39) D3022N probably benign Het
Ep400 G A 5: 110,901,725 (GRCm39) T464I probably damaging Het
Epc1 T C 18: 6,449,138 (GRCm39) N453S possibly damaging Het
Eral1 A T 11: 77,969,130 (GRCm39) N123K probably damaging Het
Ercc5 G A 1: 44,198,017 (GRCm39) V145I probably benign Het
Evc A G 5: 37,481,057 (GRCm39) S263P probably damaging Het
Fancc A T 13: 63,495,378 (GRCm39) M182K probably benign Het
Fbxl3 G T 14: 103,320,526 (GRCm39) A355E probably damaging Het
Fig4 A C 10: 41,064,628 (GRCm39) S872A probably damaging Het
Gm14393 C A 2: 174,904,497 (GRCm39) probably benign Het
Gm27013 A T 6: 130,498,003 (GRCm39) noncoding transcript Het
Gprc5a T A 6: 135,060,450 (GRCm39) M313K probably benign Het
H2ac15 T C 13: 21,937,882 (GRCm39) N39S possibly damaging Het
H2-T3 T C 17: 36,500,236 (GRCm39) probably null Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hook3 T G 8: 26,522,039 (GRCm39) K679T probably damaging Het
Ints2 G T 11: 86,140,101 (GRCm39) R244S probably damaging Het
Itgb4 T C 11: 115,884,151 (GRCm39) V945A probably damaging Het
Itih2 C T 2: 10,115,211 (GRCm39) S387N probably benign Het
Jmjd7 T A 2: 119,862,649 (GRCm39) M306K probably benign Het
Klra2 T A 6: 131,207,120 (GRCm39) D163V probably benign Het
Kmo T A 1: 175,478,138 (GRCm39) M208K probably damaging Het
Kmo G T 1: 175,478,139 (GRCm39) M208I possibly damaging Het
Masp2 A G 4: 148,698,358 (GRCm39) T480A probably damaging Het
Mogs G T 6: 83,095,619 (GRCm39) R812L possibly damaging Het
Mrpl43 A G 19: 44,994,328 (GRCm39) I97T possibly damaging Het
Myoz1 A G 14: 20,700,663 (GRCm39) W185R probably damaging Het
Ncam2 T A 16: 81,262,457 (GRCm39) H303Q probably benign Het
Ntaq1 A T 15: 58,011,740 (GRCm39) I34F probably damaging Het
Nufip2 T C 11: 77,632,554 (GRCm39) V690A unknown Het
Obox1 A T 7: 15,290,152 (GRCm39) N165I possibly damaging Het
Or1j1 C T 2: 36,702,537 (GRCm39) C189Y probably damaging Het
Or4b1d T A 2: 89,968,558 (GRCm39) E308D probably benign Het
Or4c113 T G 2: 88,885,498 (GRCm39) I91L possibly damaging Het
Or6c35 A G 10: 129,169,142 (GRCm39) T131A probably benign Het
Pex1 A G 5: 3,683,885 (GRCm39) Y1127C probably damaging Het
Pno1 T C 11: 17,161,438 (GRCm39) K24E probably benign Het
Qdpr T A 5: 45,596,669 (GRCm39) N165I possibly damaging Het
Robo2 A G 16: 73,758,761 (GRCm39) V674A probably damaging Het
Runx1t1 A T 4: 13,889,864 (GRCm39) T598S unknown Het
Samd11 A G 4: 156,333,889 (GRCm39) L174P probably damaging Het
Scn2a T A 2: 65,573,395 (GRCm39) probably null Het
Slc4a1 G T 11: 102,252,245 (GRCm39) probably benign Het
Snx25 A T 8: 46,569,474 (GRCm39) probably benign Het
Sox2 A G 3: 34,705,193 (GRCm39) N210S probably benign Het
Spag6 T C 2: 18,736,958 (GRCm39) probably null Het
Speer4b A T 5: 27,703,036 (GRCm39) L154Q probably null Het
Stt3a T A 9: 36,653,089 (GRCm39) Q531L probably damaging Het
Tcl1 A C 12: 105,183,767 (GRCm39) probably benign Het
Trip11 A T 12: 101,849,600 (GRCm39) M1488K possibly damaging Het
Ttn T C 2: 76,798,747 (GRCm39) H509R probably benign Het
Ulk3 C T 9: 57,501,593 (GRCm39) L425F possibly damaging Het
Vmn1r238 T A 18: 3,123,294 (GRCm39) K40M probably damaging Het
Vopp1 G A 6: 57,731,533 (GRCm39) P153S probably damaging Het
Zbtb42 C T 12: 112,646,976 (GRCm39) R384W probably damaging Het
Zfp14 G T 7: 29,738,341 (GRCm39) Q215K probably damaging Het
Zfp473 A T 7: 44,382,376 (GRCm39) Y651* probably null Het
Zfp735 G T 11: 73,580,550 (GRCm39) E16D possibly damaging Het
Zfp846 G T 9: 20,504,809 (GRCm39) C223F probably damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130,799,999 (GRCm39) missense probably damaging 1.00
IGL00571:Atrn APN 2 130,836,968 (GRCm39) missense probably damaging 1.00
IGL01092:Atrn APN 2 130,789,556 (GRCm39) nonsense probably null
IGL01572:Atrn APN 2 130,844,715 (GRCm39) missense probably damaging 1.00
IGL01924:Atrn APN 2 130,777,485 (GRCm39) missense probably damaging 1.00
IGL02116:Atrn APN 2 130,800,009 (GRCm39) missense probably damaging 1.00
IGL02372:Atrn APN 2 130,844,674 (GRCm39) splice site probably benign
IGL02390:Atrn APN 2 130,862,897 (GRCm39) missense possibly damaging 0.82
IGL02548:Atrn APN 2 130,814,202 (GRCm39) missense probably damaging 1.00
IGL02749:Atrn APN 2 130,789,654 (GRCm39) splice site probably benign
IGL02749:Atrn APN 2 130,812,064 (GRCm39) nonsense probably null
BB010:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
BB020:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R0026:Atrn UTSW 2 130,799,840 (GRCm39) missense probably damaging 1.00
R0403:Atrn UTSW 2 130,748,779 (GRCm39) missense probably damaging 1.00
R0479:Atrn UTSW 2 130,841,085 (GRCm39) nonsense probably null
R0544:Atrn UTSW 2 130,828,746 (GRCm39) missense probably damaging 1.00
R0570:Atrn UTSW 2 130,822,054 (GRCm39) missense probably benign 0.01
R0606:Atrn UTSW 2 130,748,776 (GRCm39) missense possibly damaging 0.90
R0617:Atrn UTSW 2 130,837,005 (GRCm39) critical splice donor site probably null
R0658:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R1108:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1112:Atrn UTSW 2 130,841,081 (GRCm39) missense probably benign 0.04
R1219:Atrn UTSW 2 130,862,927 (GRCm39) missense possibly damaging 0.90
R1422:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1524:Atrn UTSW 2 130,799,000 (GRCm39) missense probably benign 0.15
R1653:Atrn UTSW 2 130,777,544 (GRCm39) missense probably benign
R1795:Atrn UTSW 2 130,814,208 (GRCm39) missense probably benign
R1807:Atrn UTSW 2 130,824,692 (GRCm39) missense possibly damaging 0.94
R1920:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1921:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1935:Atrn UTSW 2 130,799,955 (GRCm39) missense probably damaging 1.00
R1982:Atrn UTSW 2 130,812,142 (GRCm39) missense probably benign
R2000:Atrn UTSW 2 130,777,508 (GRCm39) missense probably damaging 1.00
R2143:Atrn UTSW 2 130,799,916 (GRCm39) missense probably benign 0.03
R2336:Atrn UTSW 2 130,799,874 (GRCm39) missense probably damaging 1.00
R2679:Atrn UTSW 2 130,803,595 (GRCm39) critical splice donor site probably null
R3426:Atrn UTSW 2 130,862,876 (GRCm39) missense probably benign 0.06
R3909:Atrn UTSW 2 130,836,127 (GRCm39) missense probably damaging 1.00
R4077:Atrn UTSW 2 130,806,850 (GRCm39) critical splice donor site probably null
R4162:Atrn UTSW 2 130,836,148 (GRCm39) splice site probably benign
R4195:Atrn UTSW 2 130,775,332 (GRCm39) missense probably damaging 1.00
R4364:Atrn UTSW 2 130,812,128 (GRCm39) missense probably benign 0.39
R4465:Atrn UTSW 2 130,802,388 (GRCm39) missense probably benign 0.08
R4510:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4511:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4527:Atrn UTSW 2 130,815,424 (GRCm39) missense probably benign 0.10
R4592:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R4658:Atrn UTSW 2 130,775,349 (GRCm39) missense probably damaging 1.00
R4735:Atrn UTSW 2 130,862,910 (GRCm39) missense probably benign 0.06
R4960:Atrn UTSW 2 130,836,967 (GRCm39) nonsense probably null
R4999:Atrn UTSW 2 130,817,874 (GRCm39) missense probably damaging 1.00
R5066:Atrn UTSW 2 130,836,113 (GRCm39) missense possibly damaging 0.60
R5080:Atrn UTSW 2 130,812,044 (GRCm39) missense possibly damaging 0.95
R5141:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R5256:Atrn UTSW 2 130,787,939 (GRCm39) missense probably benign 0.39
R5494:Atrn UTSW 2 130,864,995 (GRCm39) missense probably damaging 1.00
R5678:Atrn UTSW 2 130,811,936 (GRCm39) missense probably damaging 0.96
R5752:Atrn UTSW 2 130,748,464 (GRCm39) unclassified probably benign
R5931:Atrn UTSW 2 130,775,356 (GRCm39) missense possibly damaging 0.56
R6023:Atrn UTSW 2 130,862,900 (GRCm39) missense probably benign 0.25
R6176:Atrn UTSW 2 130,788,011 (GRCm39) missense probably benign 0.31
R6377:Atrn UTSW 2 130,821,889 (GRCm39) missense probably damaging 1.00
R6433:Atrn UTSW 2 130,864,947 (GRCm39) missense probably damaging 1.00
R7226:Atrn UTSW 2 130,828,664 (GRCm39) missense probably damaging 0.99
R7402:Atrn UTSW 2 130,789,520 (GRCm39) missense probably damaging 1.00
R7541:Atrn UTSW 2 130,803,491 (GRCm39) missense possibly damaging 0.46
R7587:Atrn UTSW 2 130,822,034 (GRCm39) missense probably damaging 1.00
R7872:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R7910:Atrn UTSW 2 130,806,807 (GRCm39) missense probably benign 0.04
R7913:Atrn UTSW 2 130,812,131 (GRCm39) missense probably damaging 1.00
R7933:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R8044:Atrn UTSW 2 130,777,449 (GRCm39) missense probably damaging 1.00
R8079:Atrn UTSW 2 130,855,561 (GRCm39) missense probably null 1.00
R8093:Atrn UTSW 2 130,817,908 (GRCm39) missense probably benign 0.00
R8203:Atrn UTSW 2 130,802,469 (GRCm39) missense probably benign 0.00
R8234:Atrn UTSW 2 130,864,920 (GRCm39) critical splice acceptor site probably null
R8462:Atrn UTSW 2 130,777,504 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,846,494 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,748,798 (GRCm39) missense probably damaging 1.00
R8831:Atrn UTSW 2 130,748,521 (GRCm39) missense probably benign 0.22
R8937:Atrn UTSW 2 130,841,157 (GRCm39) missense probably benign 0.00
R9161:Atrn UTSW 2 130,777,470 (GRCm39) missense probably damaging 1.00
R9722:Atrn UTSW 2 130,803,536 (GRCm39) missense probably damaging 1.00
R9786:Atrn UTSW 2 130,786,809 (GRCm39) missense probably damaging 1.00
RF009:Atrn UTSW 2 130,748,842 (GRCm39) missense probably benign 0.12
X0024:Atrn UTSW 2 130,800,059 (GRCm39) missense probably damaging 1.00
Z1088:Atrn UTSW 2 130,815,319 (GRCm39) missense probably benign
Z1176:Atrn UTSW 2 130,788,113 (GRCm39) missense probably benign 0.27
Z1177:Atrn UTSW 2 130,787,962 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGACCAGTGTCTCTTTGGG -3'
(R):5'- AAAGGTATTTCTGTACCCTGTGC -3'

Sequencing Primer
(F):5'- GGGTCTTAATTTCCAGCAAACC -3'
(R):5'- GTAACTGATTTACTGCATGGAACAC -3'
Posted On 2015-09-24