Incidental Mutation 'R4586:Ddx27'
ID344082
Institutional Source Beutler Lab
Gene Symbol Ddx27
Ensembl Gene ENSMUSG00000017999
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 27
Synonyms
MMRRC Submission 041807-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R4586 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167015193-167034947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 167019984 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 135 (D135E)
Ref Sequence ENSEMBL: ENSMUSP00000135265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018143] [ENSMUST00000150571] [ENSMUST00000176066]
Predicted Effect probably benign
Transcript: ENSMUST00000018143
AA Change: D135E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018143
Gene: ENSMUSG00000017999
AA Change: D135E

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
DEXDc 203 404 2.24e-56 SMART
HELICc 443 524 1.71e-29 SMART
coiled coil region 577 613 N/A INTRINSIC
low complexity region 622 629 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150571
AA Change: D135E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135265
Gene: ENSMUSG00000017999
AA Change: D135E

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
Pfam:DEAD 208 292 2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176066
AA Change: D135E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135815
Gene: ENSMUSG00000017999
AA Change: D135E

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
low complexity region 171 198 N/A INTRINSIC
Pfam:DEAD 236 309 1e-17 PFAM
Meta Mutation Damage Score 0.0646 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein involved in the processing of 5.8S and 28S ribosomal RNAs. More specifically, the encoded protein localizes to the nucleolus, where it interacts with the PeBoW complex to ensure proper 3' end formation of 47S rRNA. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A T 16: 90,927,426 V136D probably damaging Het
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Aqr T C 2: 114,112,577 T1172A probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Atrn T C 2: 130,982,042 F967S probably damaging Het
Btnl1 A G 17: 34,382,462 D323G probably damaging Het
Cadps C A 14: 12,505,808 C754F probably damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Cic A T 7: 25,272,778 I645L probably benign Het
Clca1 C A 3: 145,016,858 C251F probably damaging Het
Cldn16 A T 16: 26,477,558 T95S probably benign Het
Cntnap4 C T 8: 112,810,710 H738Y probably benign Het
Col8a2 A T 4: 126,311,019 probably benign Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cyp4a12a T C 4: 115,327,312 F295L probably benign Het
Cyp4a12b T G 4: 115,432,506 M190R probably damaging Het
Dagla A G 19: 10,271,009 Y96H probably damaging Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Dnhd1 T C 7: 105,678,049 L735P probably damaging Het
Dnmt1 G A 9: 20,926,693 P242S probably benign Het
Dync1h1 G A 12: 110,649,483 D3022N probably benign Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 T C 18: 6,449,138 N453S possibly damaging Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Ercc5 G A 1: 44,158,857 V145I probably benign Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Fig4 A C 10: 41,188,632 S872A probably damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm16432 A G 1: 178,122,785 D734G possibly damaging Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gprc5a T A 6: 135,083,452 M313K probably benign Het
H2-T3 T C 17: 36,189,344 probably null Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Hook3 T G 8: 26,032,011 K679T probably damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Jmjd7 T A 2: 120,032,168 M306K probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Kmo T A 1: 175,650,572 M208K probably damaging Het
Kmo G T 1: 175,650,573 M208I possibly damaging Het
Masp2 A G 4: 148,613,901 T480A probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mrpl43 A G 19: 45,005,889 I97T possibly damaging Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Ncam2 T A 16: 81,465,569 H303Q probably benign Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Pno1 T C 11: 17,211,438 K24E probably benign Het
Qdpr T A 5: 45,439,327 N165I possibly damaging Het
Robo2 A G 16: 73,961,873 V674A probably damaging Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Samd11 A G 4: 156,249,432 L174P probably damaging Het
Scn2a T A 2: 65,743,051 probably null Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx25 A T 8: 46,116,437 probably benign Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Stt3a T A 9: 36,741,793 Q531L probably damaging Het
Tcl1 A C 12: 105,217,508 probably benign Het
Trip11 A T 12: 101,883,341 M1488K possibly damaging Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Ulk3 C T 9: 57,594,310 L425F possibly damaging Het
Vmn1r238 T A 18: 3,123,294 K40M probably damaging Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdyhv1 A T 15: 58,148,344 I34F probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Zfp846 G T 9: 20,593,513 C223F probably damaging Het
Other mutations in Ddx27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ddx27 APN 2 167019966 missense probably benign 0.00
IGL01610:Ddx27 APN 2 167022044 splice site probably benign
IGL01724:Ddx27 APN 2 167028389 missense probably damaging 1.00
IGL02035:Ddx27 APN 2 167029512 missense probably benign 0.00
IGL02141:Ddx27 APN 2 167020523 missense possibly damaging 0.67
IGL02402:Ddx27 APN 2 167015325 utr 5 prime probably benign
IGL02600:Ddx27 APN 2 167026204 missense probably damaging 1.00
IGL02882:Ddx27 APN 2 167027913 missense possibly damaging 0.86
IGL03177:Ddx27 APN 2 167027920 missense possibly damaging 0.76
R1938:Ddx27 UTSW 2 167034109 missense probably damaging 1.00
R2020:Ddx27 UTSW 2 167033771 missense probably damaging 1.00
R2038:Ddx27 UTSW 2 167033755 missense probably damaging 1.00
R2116:Ddx27 UTSW 2 167027764 missense probably benign 0.23
R3103:Ddx27 UTSW 2 167026246 missense probably damaging 1.00
R4524:Ddx27 UTSW 2 167027720 nonsense probably null
R4737:Ddx27 UTSW 2 167029299 missense probably benign 0.37
R5350:Ddx27 UTSW 2 167027860 unclassified probably benign
R5568:Ddx27 UTSW 2 167029519 missense possibly damaging 0.78
R5573:Ddx27 UTSW 2 167017886 missense possibly damaging 0.87
R5606:Ddx27 UTSW 2 167019966 missense probably benign 0.00
R6026:Ddx27 UTSW 2 167033640 missense probably benign 0.00
R6699:Ddx27 UTSW 2 167020503 missense possibly damaging 0.92
R6845:Ddx27 UTSW 2 167022096 missense probably damaging 1.00
R6941:Ddx27 UTSW 2 167015377 missense possibly damaging 0.93
R7352:Ddx27 UTSW 2 167029513 missense probably benign 0.03
R7765:Ddx27 UTSW 2 167027959 missense probably damaging 1.00
Z1177:Ddx27 UTSW 2 167033841 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGCATCGCTTCTCTTAGG -3'
(R):5'- ACTCCGTGGAGCTGAGAATG -3'

Sequencing Primer
(F):5'- AGCATCGCTTCTCTTAGGTTCTG -3'
(R):5'- AGAAGCCCTGATATGGTGGCC -3'
Posted On2015-09-24