Mutagenetix > Incidental Mutation

Incidental Mutation 'R0064:Cdon'

34409

Institutional Source

Beutler Lab

Gene Symbol

Cdon

Ensembl Gene

ENSMUSG00000038119

Gene Name

cell adhesion molecule-related/down-regulated by oncogenes

Synonyms

CDO, CAM-related/down-regulated by oncogenes

MMRRC Submission

038356-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.304) question?

Stock #

R0064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35421128-35507652 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35489227 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1079 (H1079R)

Ref Sequence

ENSEMBL: ENSMUSP00000113977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129]

AlphaFold

Q32MD9

Predicted Effect

probably benign
Transcript: ENSMUST00000042842
AA Change: H1079R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: H1079R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	40	103	1.35e-9	SMART
IG	125	212	7.25e-1	SMART
IGc2	233	296	1.38e-6	SMART
IGc2	323	386	4.62e-17	SMART
IGc2	416	506	5e-13	SMART
FN3	573	660	2.18e-2	SMART
FN3	717	800	1.89e-11	SMART
FN3	822	909	7.01e-6	SMART
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1101	1111	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119129
AA Change: H1079R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: H1079R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	40	103	1.35e-9	SMART
IG	125	212	7.25e-1	SMART
IGc2	233	296	1.38e-6	SMART
IGc2	323	386	4.62e-17	SMART
IGc2	416	506	5e-13	SMART
FN3	573	660	2.18e-2	SMART
FN3	717	800	1.89e-11	SMART
FN3	822	909	7.01e-6	SMART
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1101	1111	N/A	INTRINSIC

Meta Mutation Damage Score

0.0968

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	C	11: 110,144,871	L641R	probably damaging	Het
Abca9	G	T	11: 110,144,872	L641M	probably damaging	Het
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Arhgef17	C	A	7: 100,881,354	M1408I	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nlrc3	G	T	16: 3,964,087	T486K	possibly damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Plce1	T	C	19: 38,780,784		probably null	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Thbs1	A	T	2: 118,123,914		probably null	Het
Tie1	A	G	4: 118,489,701	V2A	possibly damaging	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Vmn2r111	T	A	17: 22,572,072	I82L	probably benign	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Cdon

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00832:Cdon	APN	9	35478116	missense	probably damaging	1.00
IGL01307:Cdon	APN	9	35457564	missense	probably benign	0.01
IGL01528:Cdon	APN	9	35470107	missense	possibly damaging	0.95
IGL01663:Cdon	APN	9	35483214	missense	possibly damaging	0.57
IGL01723:Cdon	APN	9	35503338	missense	probably benign	0.05
IGL02200:Cdon	APN	9	35483109	missense	probably benign	0.28
IGL02444:Cdon	APN	9	35473448	missense	probably benign	0.09
IGL02547:Cdon	APN	9	35478654	missense	probably damaging	1.00
IGL02620:Cdon	APN	9	35452799	missense	probably benign	0.00
IGL02861:Cdon	APN	9	35486957	missense	probably damaging	0.96
IGL02894:Cdon	APN	9	35455426	missense	probably benign	0.01
IGL03153:Cdon	APN	9	35477959	missense	probably damaging	1.00
IGL03206:Cdon	APN	9	35503306	missense	probably benign
IGL03374:Cdon	APN	9	35478003	missense	possibly damaging	0.46
corleone	UTSW	9	35486956	nonsense	probably null
indentured	UTSW	9	35452106	start codon destroyed	probably null	1.00
Molar	UTSW	9	35463895	missense	probably benign	0.15
Servitude	UTSW	9	35476948	missense	probably damaging	1.00
PIT4280001:Cdon	UTSW	9	35486935	missense	probably damaging	1.00
R0045:Cdon	UTSW	9	35486807	missense	probably benign
R0045:Cdon	UTSW	9	35486807	missense	probably benign
R0396:Cdon	UTSW	9	35470130	missense	probably damaging	1.00
R0403:Cdon	UTSW	9	35473500	missense	probably benign	0.00
R0490:Cdon	UTSW	9	35452682	missense	probably damaging	1.00
R0547:Cdon	UTSW	9	35457498	missense	possibly damaging	0.88
R0609:Cdon	UTSW	9	35478611	missense	probably damaging	1.00
R0645:Cdon	UTSW	9	35477083	splice site	probably null
R0781:Cdon	UTSW	9	35456437	splice site	probably benign
R1110:Cdon	UTSW	9	35456437	splice site	probably benign
R1391:Cdon	UTSW	9	35504189	missense	possibly damaging	0.51
R1574:Cdon	UTSW	9	35452937	splice site	probably benign
R1851:Cdon	UTSW	9	35483158	missense	probably damaging	1.00
R2031:Cdon	UTSW	9	35504074	missense	probably damaging	0.96
R2230:Cdon	UTSW	9	35491926	critical splice donor site	probably null
R3683:Cdon	UTSW	9	35489032	missense	possibly damaging	0.89
R3684:Cdon	UTSW	9	35489032	missense	possibly damaging	0.89
R3685:Cdon	UTSW	9	35489032	missense	possibly damaging	0.89
R3941:Cdon	UTSW	9	35464171	missense	probably benign	0.09
R4030:Cdon	UTSW	9	35491906	missense	probably damaging	1.00
R4084:Cdon	UTSW	9	35478131	missense	probably damaging	0.98
R4462:Cdon	UTSW	9	35457580	missense	probably damaging	0.97
R4569:Cdon	UTSW	9	35476969	missense	probably damaging	1.00
R4677:Cdon	UTSW	9	35478605	missense	probably damaging	1.00
R4869:Cdon	UTSW	9	35452904	missense	possibly damaging	0.71
R5032:Cdon	UTSW	9	35489034	missense	probably damaging	1.00
R5047:Cdon	UTSW	9	35478639	missense	probably damaging	1.00
R5214:Cdon	UTSW	9	35483208	missense	probably damaging	1.00
R5341:Cdon	UTSW	9	35470135	missense	probably damaging	1.00
R5410:Cdon	UTSW	9	35470035	missense	probably damaging	0.99
R5581:Cdon	UTSW	9	35504081	missense	probably benign	0.01
R5696:Cdon	UTSW	9	35491866	missense	possibly damaging	0.69
R5757:Cdon	UTSW	9	35452772	missense	probably damaging	0.98
R5802:Cdon	UTSW	9	35454420	missense	probably damaging	0.99
R5845:Cdon	UTSW	9	35457466	missense	probably damaging	1.00
R5949:Cdon	UTSW	9	35486951	missense	probably benign	0.32
R6106:Cdon	UTSW	9	35455408	nonsense	probably null
R6245:Cdon	UTSW	9	35476939	missense	probably damaging	1.00
R6845:Cdon	UTSW	9	35486956	nonsense	probably null
R6896:Cdon	UTSW	9	35452106	start codon destroyed	probably null	1.00
R7060:Cdon	UTSW	9	35486909	missense	probably damaging	1.00
R7076:Cdon	UTSW	9	35504150	missense	probably benign	0.00
R7184:Cdon	UTSW	9	35463895	missense	probably benign	0.15
R7382:Cdon	UTSW	9	35478648	missense	probably damaging	1.00
R7763:Cdon	UTSW	9	35454415	nonsense	probably null
R7857:Cdon	UTSW	9	35456612	missense	possibly damaging	0.79
R7885:Cdon	UTSW	9	35456522	missense	probably benign	0.01
R7894:Cdon	UTSW	9	35476948	missense	probably damaging	1.00
R7984:Cdon	UTSW	9	35503302	missense	probably benign	0.00
R8287:Cdon	UTSW	9	35463929	missense	probably benign
R8428:Cdon	UTSW	9	35491867	missense	probably benign	0.21
R8519:Cdon	UTSW	9	35478654	missense	probably damaging	1.00
R8698:Cdon	UTSW	9	35486973	critical splice donor site	probably null
R8797:Cdon	UTSW	9	35478635	missense	probably damaging	1.00
R8995:Cdon	UTSW	9	35486797	missense	probably damaging	1.00
R9090:Cdon	UTSW	9	35491879	missense	probably damaging	0.98
R9177:Cdon	UTSW	9	35469934	missense	probably benign	0.00
R9200:Cdon	UTSW	9	35503321	missense	probably benign	0.00
R9271:Cdon	UTSW	9	35491879	missense	probably damaging	0.98
R9330:Cdon	UTSW	9	35488979	nonsense	probably null
R9477:Cdon	UTSW	9	35491905	missense	probably damaging	1.00
R9612:Cdon	UTSW	9	35486905	missense	probably damaging	1.00
R9730:Cdon	UTSW	9	35486967	missense	probably benign	0.00
Z1177:Cdon	UTSW	9	35491900	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATACCACTCTCTCAGGAGCAGCC -3'
(R):5'- TCCTCCATTTGCCAAGCCTAACAG -3'

Sequencing Primer
(F):5'- CCGGATCAACGGGAGTG -3'
(R):5'- GTCTCAAGAATAGCTCTCAGTGTG -3'

Posted On

2013-05-09