Mutagenetix > Incidental Mutation

Incidental Mutation 'R4586:Col8a2'

344090

Institutional Source

Beutler Lab

Gene Symbol

Col8a2

Ensembl Gene

ENSMUSG00000056174

Gene Name

collagen, type VIII, alpha 2

Synonyms

MMRRC Submission

041807-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R4586 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126286793-126314330 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 126311019 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000123003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070132] [ENSMUST00000128435]

AlphaFold

P25318

Predicted Effect

unknown
Transcript: ENSMUST00000070132
AA Change: D274V

SMART Domains

Protein: ENSMUSP00000070270
Gene: ENSMUSG00000056174
AA Change: D274V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	25	33	N/A	INTRINSIC
low complexity region	60	69	N/A	INTRINSIC
low complexity region	72	105	N/A	INTRINSIC
Pfam:Collagen	116	168	1.2e-9	PFAM
low complexity region	207	237	N/A	INTRINSIC
internal_repeat_1	240	259	1.3e-7	PROSPERO
low complexity region	260	327	N/A	INTRINSIC
low complexity region	342	387	N/A	INTRINSIC
internal_repeat_1	388	407	1.3e-7	PROSPERO
low complexity region	408	429	N/A	INTRINSIC
low complexity region	440	459	N/A	INTRINSIC
low complexity region	471	530	N/A	INTRINSIC
low complexity region	545	557	N/A	INTRINSIC
C1Q	564	699	2.44e-78	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128435

SMART Domains

Protein: ENSMUSP00000123003
Gene: ENSMUSG00000056174

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	25	33	N/A	INTRINSIC

Meta Mutation Damage Score

0.0907

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 2 chain of type VIII collagen. This protein is a major component of the basement membrane of the corneal endothelium and forms homo- or heterotrimers with alpha 1 (VIII) type collagens. Defects in this gene are associated with Fuchs endothelial corneal dystrophy and posterior polymorphous corneal dystrophy type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a thinner Descemet's membrane of the cornea. Mice heterozygous or homozygous for an ENU-induced mutation exhibit thin cornea, corneal epithelium, stroma, and Descemet membrane, and enlarged anterior chamber. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	A	T	16: 90,927,426	V136D	probably damaging	Het
Akap9	T	C	5: 3,976,151	S1269P	probably benign	Het
Aqr	T	C	2: 114,112,577	T1172A	probably benign	Het
Art2a-ps	A	T	7: 101,554,749	L194*	probably null	Het
Atrn	T	C	2: 130,982,042	F967S	probably damaging	Het
Btnl1	A	G	17: 34,382,462	D323G	probably damaging	Het
Cadps	C	A	14: 12,505,808	C754F	probably damaging	Het
Ccdc7b	A	G	8: 129,110,920	T131A	probably benign	Het
Cic	A	T	7: 25,272,778	I645L	probably benign	Het
Clca1	C	A	3: 145,016,858	C251F	probably damaging	Het
Cldn16	A	T	16: 26,477,558	T95S	probably benign	Het
Cntnap4	C	T	8: 112,810,710	H738Y	probably benign	Het
Corin	A	T	5: 72,329,699	V706D	probably damaging	Het
Cuzd1	G	A	7: 131,314,800	P310L	probably damaging	Het
Cyp4a12a	T	C	4: 115,327,312	F295L	probably benign	Het
Cyp4a12b	T	G	4: 115,432,506	M190R	probably damaging	Het
Dagla	A	G	19: 10,271,009	Y96H	probably damaging	Het
Dapp1	T	C	3: 137,939,171	Q148R	probably benign	Het
Dcaf17	T	A	2: 71,088,580	S499R	probably benign	Het
Ddx27	T	A	2: 167,019,984	D135E	probably benign	Het
Defb3	A	T	8: 19,295,156	I43F	possibly damaging	Het
Dnajc10	T	G	2: 80,347,778	F710V	probably damaging	Het
Dnhd1	T	C	7: 105,678,049	L735P	probably damaging	Het
Dnmt1	G	A	9: 20,926,693	P242S	probably benign	Het
Dync1h1	G	A	12: 110,649,483	D3022N	probably benign	Het
Ep400	G	A	5: 110,753,859	T464I	probably damaging	Het
Epc1	T	C	18: 6,449,138	N453S	possibly damaging	Het
Eral1	A	T	11: 78,078,304	N123K	probably damaging	Het
Ercc5	G	A	1: 44,158,857	V145I	probably benign	Het
Evc	A	G	5: 37,323,713	S263P	probably damaging	Het
Fancc	A	T	13: 63,347,564	M182K	probably benign	Het
Fbxl3	G	T	14: 103,083,090	A355E	probably damaging	Het
Fig4	A	C	10: 41,188,632	S872A	probably damaging	Het
Gm14393	C	A	2: 175,062,704		probably benign	Het
Gm16432	A	G	1: 178,122,785	D734G	possibly damaging	Het
Gm27013	A	T	6: 130,521,040		noncoding transcript	Het
Gprc5a	T	A	6: 135,083,452	M313K	probably benign	Het
H2-T3	T	C	17: 36,189,344		probably null	Het
Hap1	G	A	11: 100,354,724	T138M	probably benign	Het
Hist1h2ak	T	C	13: 21,753,712	N39S	possibly damaging	Het
Hook3	T	G	8: 26,032,011	K679T	probably damaging	Het
Ints2	G	T	11: 86,249,275	R244S	probably damaging	Het
Itgb4	T	C	11: 115,993,325	V945A	probably damaging	Het
Itih2	C	T	2: 10,110,400	S387N	probably benign	Het
Jmjd7	T	A	2: 120,032,168	M306K	probably benign	Het
Klra2	T	A	6: 131,230,157	D163V	probably benign	Het
Kmo	T	A	1: 175,650,572	M208K	probably damaging	Het
Kmo	G	T	1: 175,650,573	M208I	possibly damaging	Het
Masp2	A	G	4: 148,613,901	T480A	probably damaging	Het
Mogs	G	T	6: 83,118,638	R812L	possibly damaging	Het
Mrpl43	A	G	19: 45,005,889	I97T	possibly damaging	Het
Myoz1	A	G	14: 20,650,595	W185R	probably damaging	Het
Ncam2	T	A	16: 81,465,569	H303Q	probably benign	Het
Nufip2	T	C	11: 77,741,728	V690A	unknown	Het
Obox1	A	T	7: 15,556,227	N165I	possibly damaging	Het
Olfr1218	T	G	2: 89,055,154	I91L	possibly damaging	Het
Olfr3	C	T	2: 36,812,525	C189Y	probably damaging	Het
Olfr32	T	A	2: 90,138,214	E308D	probably benign	Het
Olfr781	A	G	10: 129,333,273	T131A	probably benign	Het
Pex1	A	G	5: 3,633,885	Y1127C	probably damaging	Het
Pno1	T	C	11: 17,211,438	K24E	probably benign	Het
Qdpr	T	A	5: 45,439,327	N165I	possibly damaging	Het
Robo2	A	G	16: 73,961,873	V674A	probably damaging	Het
Runx1t1	A	T	4: 13,889,864	T598S	unknown	Het
Samd11	A	G	4: 156,249,432	L174P	probably damaging	Het
Scn2a	T	A	2: 65,743,051		probably null	Het
Slc4a1	G	T	11: 102,361,419		probably benign	Het
Snx25	A	T	8: 46,116,437		probably benign	Het
Sox2	A	G	3: 34,651,044	N210S	probably benign	Het
Spag6	T	C	2: 18,732,147		probably null	Het
Speer4b	A	T	5: 27,498,038	L154Q	probably null	Het
Stt3a	T	A	9: 36,741,793	Q531L	probably damaging	Het
Tcl1	A	C	12: 105,217,508		probably benign	Het
Trip11	A	T	12: 101,883,341	M1488K	possibly damaging	Het
Ttn	T	C	2: 76,968,403	H509R	probably benign	Het
Ulk3	C	T	9: 57,594,310	L425F	possibly damaging	Het
Vmn1r238	T	A	18: 3,123,294	K40M	probably damaging	Het
Vopp1	G	A	6: 57,754,548	P153S	probably damaging	Het
Wdyhv1	A	T	15: 58,148,344	I34F	probably damaging	Het
Zbtb42	C	T	12: 112,680,542	R384W	probably damaging	Het
Zfp14	G	T	7: 30,038,916	Q215K	probably damaging	Het
Zfp473	A	T	7: 44,732,952	Y651*	probably null	Het
Zfp735	G	T	11: 73,689,724	E16D	possibly damaging	Het
Zfp846	G	T	9: 20,593,513	C223F	probably damaging	Het

Other mutations in Col8a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Col8a2	APN	4	126309791	missense	probably damaging	0.99
IGL01776:Col8a2	APN	4	126309805	unclassified	probably benign
IGL03367:Col8a2	APN	4	126312198	missense	probably damaging	1.00
R1861:Col8a2	UTSW	4	126311624	unclassified	probably benign
R1909:Col8a2	UTSW	4	126312133	missense	possibly damaging	0.63
R2038:Col8a2	UTSW	4	126311315	unclassified	probably benign
R2866:Col8a2	UTSW	4	126311199	unclassified	probably benign
R4013:Col8a2	UTSW	4	126311115	unclassified	probably benign
R4995:Col8a2	UTSW	4	126310788	missense	probably damaging	0.98
R5160:Col8a2	UTSW	4	126310412	missense	possibly damaging	0.77
R5574:Col8a2	UTSW	4	126311268	unclassified	probably benign
R5858:Col8a2	UTSW	4	126311300	unclassified	probably benign
R6803:Col8a2	UTSW	4	126312000	missense	probably damaging	1.00
R8876:Col8a2	UTSW	4	126310854	missense	probably damaging	0.96
R9523:Col8a2	UTSW	4	126311480	missense	unknown
Z1177:Col8a2	UTSW	4	126311543	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATTACTGTCCCTGGAAAACCAG -3'
(R):5'- TCTGTCTCCTAAGAGCCCTG -3'

Sequencing Primer
(F):5'- TCCAGGGCCTCCAGGATTTAG -3'
(R):5'- CCCTGGGGCCCCAACTG -3'

Posted On

2015-09-24