Incidental Mutation 'R4586:Speer4b'
ID344095
Institutional Source Beutler Lab
Gene Symbol Speer4b
Ensembl Gene ENSMUSG00000048703
Gene Namespermatogenesis associated glutamate (E)-rich protein 4B
Synonyms1700081O22Rik, SPEER-4B
MMRRC Submission 041807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4586 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location27495639-27501438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27498038 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 154 (L154Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053257] [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]
Predicted Effect probably null
Transcript: ENSMUST00000053257
AA Change: L156Q

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062903
Gene: ENSMUSG00000048703
AA Change: L156Q

DomainStartEndE-ValueType
Pfam:Takusan 50 134 9.6e-27 PFAM
low complexity region 154 168 N/A INTRINSIC
low complexity region 235 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071500
SMART Domains Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Pfam:DPPIV_N 134 500 7.2e-114 PFAM
Pfam:PD40 365 402 1.1e-5 PFAM
Pfam:Peptidase_S9 579 789 2.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101471
SMART Domains Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:DPPIV_N 133 499 2.6e-114 PFAM
Pfam:PD40 364 401 9.3e-6 PFAM
Pfam:Peptidase_S9 578 788 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120555
SMART Domains Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:DPPIV_N 131 497 2.6e-114 PFAM
Pfam:PD40 362 399 9.2e-6 PFAM
Pfam:Peptidase_S9 576 786 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122171
SMART Domains Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:DPPIV_N 189 555 6.4e-113 PFAM
Pfam:PD40 425 457 1.1e-4 PFAM
Pfam:Peptidase_S9 634 844 4.3e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124535
Predicted Effect probably null
Transcript: ENSMUST00000155721
AA Change: L154Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122872
Gene: ENSMUSG00000048703
AA Change: L154Q

DomainStartEndE-ValueType
Pfam:Takusan 49 133 6.2e-27 PFAM
low complexity region 153 167 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (96/96)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A T 16: 90,927,426 V136D probably damaging Het
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Aqr T C 2: 114,112,577 T1172A probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Atrn T C 2: 130,982,042 F967S probably damaging Het
Btnl1 A G 17: 34,382,462 D323G probably damaging Het
Cadps C A 14: 12,505,808 C754F probably damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Cic A T 7: 25,272,778 I645L probably benign Het
Clca1 C A 3: 145,016,858 C251F probably damaging Het
Cldn16 A T 16: 26,477,558 T95S probably benign Het
Cntnap4 C T 8: 112,810,710 H738Y probably benign Het
Col8a2 A T 4: 126,311,019 probably benign Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cyp4a12a T C 4: 115,327,312 F295L probably benign Het
Cyp4a12b T G 4: 115,432,506 M190R probably damaging Het
Dagla A G 19: 10,271,009 Y96H probably damaging Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Ddx27 T A 2: 167,019,984 D135E probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Dnhd1 T C 7: 105,678,049 L735P probably damaging Het
Dnmt1 G A 9: 20,926,693 P242S probably benign Het
Dync1h1 G A 12: 110,649,483 D3022N probably benign Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 T C 18: 6,449,138 N453S possibly damaging Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Ercc5 G A 1: 44,158,857 V145I probably benign Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Fig4 A C 10: 41,188,632 S872A probably damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm16432 A G 1: 178,122,785 D734G possibly damaging Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gprc5a T A 6: 135,083,452 M313K probably benign Het
H2-T3 T C 17: 36,189,344 probably null Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Hook3 T G 8: 26,032,011 K679T probably damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Jmjd7 T A 2: 120,032,168 M306K probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Kmo T A 1: 175,650,572 M208K probably damaging Het
Kmo G T 1: 175,650,573 M208I possibly damaging Het
Masp2 A G 4: 148,613,901 T480A probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mrpl43 A G 19: 45,005,889 I97T possibly damaging Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Ncam2 T A 16: 81,465,569 H303Q probably benign Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Pno1 T C 11: 17,211,438 K24E probably benign Het
Qdpr T A 5: 45,439,327 N165I possibly damaging Het
Robo2 A G 16: 73,961,873 V674A probably damaging Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Samd11 A G 4: 156,249,432 L174P probably damaging Het
Scn2a T A 2: 65,743,051 probably null Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx25 A T 8: 46,116,437 probably benign Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Stt3a T A 9: 36,741,793 Q531L probably damaging Het
Tcl1 A C 12: 105,217,508 probably benign Het
Trip11 A T 12: 101,883,341 M1488K possibly damaging Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Ulk3 C T 9: 57,594,310 L425F possibly damaging Het
Vmn1r238 T A 18: 3,123,294 K40M probably damaging Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdyhv1 A T 15: 58,148,344 I34F probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Zfp846 G T 9: 20,593,513 C223F probably damaging Het
Other mutations in Speer4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Speer4b APN 5 27498718 missense probably damaging 0.99
IGL00990:Speer4b APN 5 27501274 missense probably damaging 1.00
IGL01343:Speer4b APN 5 27497883 missense probably benign
R1586:Speer4b UTSW 5 27497013 missense probably damaging 0.98
R1772:Speer4b UTSW 5 27500238 splice site probably benign
R4239:Speer4b UTSW 5 27501313 missense probably benign 0.17
R4585:Speer4b UTSW 5 27498038 missense probably null 1.00
R4659:Speer4b UTSW 5 27497895 missense probably benign
R4915:Speer4b UTSW 5 27500136 missense probably benign 0.00
R4927:Speer4b UTSW 5 27501265 missense probably damaging 0.97
R5619:Speer4b UTSW 5 27498817 missense possibly damaging 0.84
R5860:Speer4b UTSW 5 27500228 missense possibly damaging 0.60
R6990:Speer4b UTSW 5 27497078 nonsense probably null
R7045:Speer4b UTSW 5 27500125 missense probably damaging 1.00
R7146:Speer4b UTSW 5 27498710 missense probably benign 0.00
R7170:Speer4b UTSW 5 27498823 missense possibly damaging 0.70
Z1088:Speer4b UTSW 5 27497941 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACATTCCATGAGGAGGGTGG -3'
(R):5'- TGTTTGTACAGCTGCCATGG -3'

Sequencing Primer
(F):5'- GCCAATGGTATCAGATAGTCATAGCC -3'
(R):5'- ACAGCTGCCATGGATGTATTGAG -3'
Posted On2015-09-24