Incidental Mutation 'R4586:Evc'
ID344096
Institutional Source Beutler Lab
Gene Symbol Evc
Ensembl Gene ENSMUSG00000029122
Gene NameEvC ciliary complex subunit 1
Synonyms
MMRRC Submission 041807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R4586 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location37289098-37336894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37323713 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 263 (S263P)
Ref Sequence ENSEMBL: ENSMUSP00000109785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031005] [ENSMUST00000114148] [ENSMUST00000114154]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031005
AA Change: S263P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031005
Gene: ENSMUSG00000029122
AA Change: S263P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 77 92 N/A INTRINSIC
low complexity region 173 183 N/A INTRINSIC
low complexity region 449 472 N/A INTRINSIC
low complexity region 640 652 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
coiled coil region 694 725 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
coiled coil region 871 911 N/A INTRINSIC
low complexity region 927 944 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114148
AA Change: S263P

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109785
Gene: ENSMUSG00000029122
AA Change: S263P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 77 92 N/A INTRINSIC
low complexity region 173 183 N/A INTRINSIC
low complexity region 449 472 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114154
AA Change: S86P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109791
Gene: ENSMUSG00000029122
AA Change: S86P

DomainStartEndE-ValueType
low complexity region 272 295 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
coiled coil region 517 548 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
coiled coil region 694 734 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133376
Meta Mutation Damage Score 0.1036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a leucine zipper and a transmembrane domain. This gene has been implicated in both Ellis-van Creveld syndrome (EvC) and Weyers acrodental dysostosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some lethality shortly after birth and exhibit aphagia, infertile, teeth abnormalities, short limbs and long bones, delays in ossification, and short ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A T 16: 90,927,426 V136D probably damaging Het
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Aqr T C 2: 114,112,577 T1172A probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Atrn T C 2: 130,982,042 F967S probably damaging Het
Btnl1 A G 17: 34,382,462 D323G probably damaging Het
Cadps C A 14: 12,505,808 C754F probably damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Cic A T 7: 25,272,778 I645L probably benign Het
Clca1 C A 3: 145,016,858 C251F probably damaging Het
Cldn16 A T 16: 26,477,558 T95S probably benign Het
Cntnap4 C T 8: 112,810,710 H738Y probably benign Het
Col8a2 A T 4: 126,311,019 probably benign Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cyp4a12a T C 4: 115,327,312 F295L probably benign Het
Cyp4a12b T G 4: 115,432,506 M190R probably damaging Het
Dagla A G 19: 10,271,009 Y96H probably damaging Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Ddx27 T A 2: 167,019,984 D135E probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Dnhd1 T C 7: 105,678,049 L735P probably damaging Het
Dnmt1 G A 9: 20,926,693 P242S probably benign Het
Dync1h1 G A 12: 110,649,483 D3022N probably benign Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 T C 18: 6,449,138 N453S possibly damaging Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Ercc5 G A 1: 44,158,857 V145I probably benign Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Fig4 A C 10: 41,188,632 S872A probably damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm16432 A G 1: 178,122,785 D734G possibly damaging Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gprc5a T A 6: 135,083,452 M313K probably benign Het
H2-T3 T C 17: 36,189,344 probably null Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Hook3 T G 8: 26,032,011 K679T probably damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Jmjd7 T A 2: 120,032,168 M306K probably benign Het
Klra2 T A 6: 131,230,157 D163V probably benign Het
Kmo T A 1: 175,650,572 M208K probably damaging Het
Kmo G T 1: 175,650,573 M208I possibly damaging Het
Masp2 A G 4: 148,613,901 T480A probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mrpl43 A G 19: 45,005,889 I97T possibly damaging Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Ncam2 T A 16: 81,465,569 H303Q probably benign Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Pno1 T C 11: 17,211,438 K24E probably benign Het
Qdpr T A 5: 45,439,327 N165I possibly damaging Het
Robo2 A G 16: 73,961,873 V674A probably damaging Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Samd11 A G 4: 156,249,432 L174P probably damaging Het
Scn2a T A 2: 65,743,051 probably null Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx25 A T 8: 46,116,437 probably benign Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Stt3a T A 9: 36,741,793 Q531L probably damaging Het
Tcl1 A C 12: 105,217,508 probably benign Het
Trip11 A T 12: 101,883,341 M1488K possibly damaging Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Ulk3 C T 9: 57,594,310 L425F possibly damaging Het
Vmn1r238 T A 18: 3,123,294 K40M probably damaging Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdyhv1 A T 15: 58,148,344 I34F probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Zfp846 G T 9: 20,593,513 C223F probably damaging Het
Other mutations in Evc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Evc APN 5 37333013 missense probably damaging 1.00
IGL01799:Evc APN 5 37324914 missense possibly damaging 0.46
IGL01806:Evc APN 5 37320234 critical splice donor site probably null
IGL01823:Evc APN 5 37328521 missense probably damaging 1.00
IGL02821:Evc APN 5 37326396 missense probably benign 0.01
R0312:Evc UTSW 5 37328541 missense possibly damaging 0.83
R0355:Evc UTSW 5 37316312 splice site probably benign
R0741:Evc UTSW 5 37326395 missense possibly damaging 0.51
R0745:Evc UTSW 5 37319059 missense probably damaging 0.99
R1498:Evc UTSW 5 37323700 missense possibly damaging 0.66
R1517:Evc UTSW 5 37319035 missense probably damaging 1.00
R2680:Evc UTSW 5 37310237 missense probably benign
R2867:Evc UTSW 5 37316275 intron probably benign
R4585:Evc UTSW 5 37323713 missense probably damaging 0.96
R4731:Evc UTSW 5 37323797 missense probably benign 0.38
R4859:Evc UTSW 5 37300909 missense probably damaging 0.96
R4963:Evc UTSW 5 37322049 critical splice donor site probably null
R5536:Evc UTSW 5 37326583 splice site probably benign
R5693:Evc UTSW 5 37320240 missense possibly damaging 0.46
R5781:Evc UTSW 5 37326570 missense probably damaging 1.00
R6251:Evc UTSW 5 37300499 missense probably benign
R7061:Evc UTSW 5 37319102 missense possibly damaging 0.66
R7286:Evc UTSW 5 37322183 nonsense probably null
R7503:Evc UTSW 5 37300767 missense unknown
R7831:Evc UTSW 5 37319083 missense probably damaging 1.00
R8344:Evc UTSW 5 37314528 missense possibly damaging 0.90
R8853:Evc UTSW 5 37303303 missense possibly damaging 0.66
X0012:Evc UTSW 5 37300729 intron probably benign
Predicted Primers PCR Primer
(F):5'- GCACAAGTGTCCTCTTTACATATGC -3'
(R):5'- ATCCAGAACAGCCCGTTGTC -3'

Sequencing Primer
(F):5'- GCACATACACTTTCACAAGTTGTC -3'
(R):5'- CAGCCCGTTGTCATGATATATAATC -3'
Posted On2015-09-24