Incidental Mutation 'R4586:Qdpr'
ID 344097
Institutional Source Beutler Lab
Gene Symbol Qdpr
Ensembl Gene ENSMUSG00000015806
Gene Name quinoid dihydropteridine reductase
Synonyms 2610008L04Rik
MMRRC Submission 041807-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.221) question?
Stock # R4586 (G1)
Quality Score 186
Status Validated
Chromosome 5
Chromosomal Location 45591374-45607571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45596669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 165 (N165I)
Ref Sequence ENSEMBL: ENSMUSP00000143584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015950] [ENSMUST00000117425] [ENSMUST00000118097] [ENSMUST00000120867] [ENSMUST00000127562] [ENSMUST00000154962] [ENSMUST00000197946] [ENSMUST00000198258]
AlphaFold Q8BVI4
Predicted Effect probably benign
Transcript: ENSMUST00000015950
AA Change: N165I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000015950
Gene: ENSMUSG00000015806
AA Change: N165I

DomainStartEndE-ValueType
Pfam:adh_short 8 195 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117425
AA Change: N113I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112469
Gene: ENSMUSG00000015806
AA Change: N113I

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118097
AA Change: N113I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113958
Gene: ENSMUSG00000015806
AA Change: N113I

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120867
AA Change: N113I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113203
Gene: ENSMUSG00000015806
AA Change: N113I

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127562
SMART Domains Protein: ENSMUSP00000115453
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 137 7e-67 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149290
Predicted Effect probably benign
Transcript: ENSMUST00000154962
SMART Domains Protein: ENSMUSP00000122081
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 159 7e-72 PDB
SCOP:d1hdr__ 6 159 6e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196216
Predicted Effect possibly damaging
Transcript: ENSMUST00000197946
AA Change: N165I

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000143584
Gene: ENSMUSG00000015806
AA Change: N165I

DomainStartEndE-ValueType
PDB:1DIR|D 1 213 1e-125 PDB
SCOP:d1hdr__ 6 162 2e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198258
AA Change: N63I

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143741
Gene: ENSMUSG00000015806
AA Change: N63I

DomainStartEndE-ValueType
PDB:1DIR|D 1 139 8e-86 PDB
SCOP:d1hdr__ 14 139 6e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200259
Meta Mutation Damage Score 0.1138 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. [provided by RefSeq, Jul 2008]
PHENOTYPE: A portion of mice homozygous for a knock-out allele display abnormal rib-sternum attachment, a split xiphoid process, and lumbar vertebral transformation. Another knock-out allele exhibits abnormal folate and biopterin metabolism and oxidative stress in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 4,026,151 (GRCm39) S1269P probably benign Het
Aqr T C 2: 113,943,058 (GRCm39) T1172A probably benign Het
Art2a A T 7: 101,203,956 (GRCm39) L194* probably null Het
Atrn T C 2: 130,823,962 (GRCm39) F967S probably damaging Het
Btnl1 A G 17: 34,601,436 (GRCm39) D323G probably damaging Het
Cadps C A 14: 12,505,808 (GRCm38) C754F probably damaging Het
Catspere2 A G 1: 177,950,351 (GRCm39) D734G possibly damaging Het
Ccdc7b A G 8: 129,837,401 (GRCm39) T131A probably benign Het
Cfap298 A T 16: 90,724,314 (GRCm39) V136D probably damaging Het
Cic A T 7: 24,972,203 (GRCm39) I645L probably benign Het
Clca3a1 C A 3: 144,722,619 (GRCm39) C251F probably damaging Het
Cldn16 A T 16: 26,296,308 (GRCm39) T95S probably benign Het
Cntnap4 C T 8: 113,537,342 (GRCm39) H738Y probably benign Het
Col8a2 A T 4: 126,204,812 (GRCm39) probably benign Het
Corin A T 5: 72,487,042 (GRCm39) V706D probably damaging Het
Cuzd1 G A 7: 130,916,529 (GRCm39) P310L probably damaging Het
Cyp4a12a T C 4: 115,184,509 (GRCm39) F295L probably benign Het
Cyp4a12b T G 4: 115,289,703 (GRCm39) M190R probably damaging Het
Dagla A G 19: 10,248,373 (GRCm39) Y96H probably damaging Het
Dapp1 T C 3: 137,644,932 (GRCm39) Q148R probably benign Het
Dcaf17 T A 2: 70,918,924 (GRCm39) S499R probably benign Het
Ddx27 T A 2: 166,861,904 (GRCm39) D135E probably benign Het
Defb3 A T 8: 19,345,172 (GRCm39) I43F possibly damaging Het
Dnajc10 T G 2: 80,178,122 (GRCm39) F710V probably damaging Het
Dnhd1 T C 7: 105,327,256 (GRCm39) L735P probably damaging Het
Dnmt1 G A 9: 20,837,989 (GRCm39) P242S probably benign Het
Dync1h1 G A 12: 110,615,917 (GRCm39) D3022N probably benign Het
Ep400 G A 5: 110,901,725 (GRCm39) T464I probably damaging Het
Epc1 T C 18: 6,449,138 (GRCm39) N453S possibly damaging Het
Eral1 A T 11: 77,969,130 (GRCm39) N123K probably damaging Het
Ercc5 G A 1: 44,198,017 (GRCm39) V145I probably benign Het
Evc A G 5: 37,481,057 (GRCm39) S263P probably damaging Het
Fancc A T 13: 63,495,378 (GRCm39) M182K probably benign Het
Fbxl3 G T 14: 103,320,526 (GRCm39) A355E probably damaging Het
Fig4 A C 10: 41,064,628 (GRCm39) S872A probably damaging Het
Gm14393 C A 2: 174,904,497 (GRCm39) probably benign Het
Gm27013 A T 6: 130,498,003 (GRCm39) noncoding transcript Het
Gprc5a T A 6: 135,060,450 (GRCm39) M313K probably benign Het
H2ac15 T C 13: 21,937,882 (GRCm39) N39S possibly damaging Het
H2-T3 T C 17: 36,500,236 (GRCm39) probably null Het
Hap1 G A 11: 100,245,550 (GRCm39) T138M probably benign Het
Hook3 T G 8: 26,522,039 (GRCm39) K679T probably damaging Het
Ints2 G T 11: 86,140,101 (GRCm39) R244S probably damaging Het
Itgb4 T C 11: 115,884,151 (GRCm39) V945A probably damaging Het
Itih2 C T 2: 10,115,211 (GRCm39) S387N probably benign Het
Jmjd7 T A 2: 119,862,649 (GRCm39) M306K probably benign Het
Klra2 T A 6: 131,207,120 (GRCm39) D163V probably benign Het
Kmo T A 1: 175,478,138 (GRCm39) M208K probably damaging Het
Kmo G T 1: 175,478,139 (GRCm39) M208I possibly damaging Het
Masp2 A G 4: 148,698,358 (GRCm39) T480A probably damaging Het
Mogs G T 6: 83,095,619 (GRCm39) R812L possibly damaging Het
Mrpl43 A G 19: 44,994,328 (GRCm39) I97T possibly damaging Het
Myoz1 A G 14: 20,700,663 (GRCm39) W185R probably damaging Het
Ncam2 T A 16: 81,262,457 (GRCm39) H303Q probably benign Het
Ntaq1 A T 15: 58,011,740 (GRCm39) I34F probably damaging Het
Nufip2 T C 11: 77,632,554 (GRCm39) V690A unknown Het
Obox1 A T 7: 15,290,152 (GRCm39) N165I possibly damaging Het
Or1j1 C T 2: 36,702,537 (GRCm39) C189Y probably damaging Het
Or4b1d T A 2: 89,968,558 (GRCm39) E308D probably benign Het
Or4c113 T G 2: 88,885,498 (GRCm39) I91L possibly damaging Het
Or6c35 A G 10: 129,169,142 (GRCm39) T131A probably benign Het
Pex1 A G 5: 3,683,885 (GRCm39) Y1127C probably damaging Het
Pno1 T C 11: 17,161,438 (GRCm39) K24E probably benign Het
Robo2 A G 16: 73,758,761 (GRCm39) V674A probably damaging Het
Runx1t1 A T 4: 13,889,864 (GRCm39) T598S unknown Het
Samd11 A G 4: 156,333,889 (GRCm39) L174P probably damaging Het
Scn2a T A 2: 65,573,395 (GRCm39) probably null Het
Slc4a1 G T 11: 102,252,245 (GRCm39) probably benign Het
Snx25 A T 8: 46,569,474 (GRCm39) probably benign Het
Sox2 A G 3: 34,705,193 (GRCm39) N210S probably benign Het
Spag6 T C 2: 18,736,958 (GRCm39) probably null Het
Speer4b A T 5: 27,703,036 (GRCm39) L154Q probably null Het
Stt3a T A 9: 36,653,089 (GRCm39) Q531L probably damaging Het
Tcl1 A C 12: 105,183,767 (GRCm39) probably benign Het
Trip11 A T 12: 101,849,600 (GRCm39) M1488K possibly damaging Het
Ttn T C 2: 76,798,747 (GRCm39) H509R probably benign Het
Ulk3 C T 9: 57,501,593 (GRCm39) L425F possibly damaging Het
Vmn1r238 T A 18: 3,123,294 (GRCm39) K40M probably damaging Het
Vopp1 G A 6: 57,731,533 (GRCm39) P153S probably damaging Het
Zbtb42 C T 12: 112,646,976 (GRCm39) R384W probably damaging Het
Zfp14 G T 7: 29,738,341 (GRCm39) Q215K probably damaging Het
Zfp473 A T 7: 44,382,376 (GRCm39) Y651* probably null Het
Zfp735 G T 11: 73,580,550 (GRCm39) E16D possibly damaging Het
Zfp846 G T 9: 20,504,809 (GRCm39) C223F probably damaging Het
Other mutations in Qdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Qdpr APN 5 45,592,018 (GRCm39) missense possibly damaging 0.93
R0907:Qdpr UTSW 5 45,596,728 (GRCm39) missense probably benign 0.16
R1387:Qdpr UTSW 5 45,607,480 (GRCm39) start gained probably benign
R1964:Qdpr UTSW 5 45,596,660 (GRCm39) missense possibly damaging 0.58
R2431:Qdpr UTSW 5 45,602,072 (GRCm39) missense probably damaging 1.00
R5678:Qdpr UTSW 5 45,604,979 (GRCm39) missense possibly damaging 0.65
R5754:Qdpr UTSW 5 45,596,727 (GRCm39) missense probably damaging 0.98
R7392:Qdpr UTSW 5 45,596,718 (GRCm39) missense probably benign 0.37
R7939:Qdpr UTSW 5 45,607,407 (GRCm39) missense probably damaging 1.00
R8482:Qdpr UTSW 5 45,596,688 (GRCm39) missense probably benign 0.05
R8891:Qdpr UTSW 5 45,604,982 (GRCm39) missense probably damaging 0.99
R8993:Qdpr UTSW 5 45,607,386 (GRCm39) missense probably damaging 1.00
R9445:Qdpr UTSW 5 45,596,669 (GRCm39) missense probably benign
X0022:Qdpr UTSW 5 45,596,697 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCTCAAAACAGATGAATGTCTGAG -3'
(R):5'- GTACCATGCTAAAGGACACAGC -3'

Sequencing Primer
(F):5'- CCAGGTCAGACTCTTAGGTTGAAAC -3'
(R):5'- GCTGTGGCTAGAGTTCTAAGGGAAC -3'
Posted On 2015-09-24