Incidental Mutation 'R4586:Klra2'
ID344104
Institutional Source Beutler Lab
Gene Symbol Klra2
Ensembl Gene ENSMUSG00000030187
Gene Namekiller cell lectin-like receptor, subfamily A, member 2
SynonymsLy49b
MMRRC Submission 041807-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4586 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location131219223-131247362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131230157 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 163 (D163V)
Ref Sequence ENSEMBL: ENSMUSP00000086252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032306] [ENSMUST00000088867]
Predicted Effect probably benign
Transcript: ENSMUST00000032306
AA Change: D163V

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032306
Gene: ENSMUSG00000030187
AA Change: D163V

DomainStartEndE-ValueType
CLECT 137 260 1.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088867
AA Change: D163V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000086252
Gene: ENSMUSG00000030187
AA Change: D163V

DomainStartEndE-ValueType
CLECT 137 293 6.54e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: The gene is a member of the large lectin-like type 2 transmembrane receptor family of the natural killer gene complex. The gene is located distantly telomeric to its family's gene cluster on chromosome 6. The gene differs from the other genes in its cluster as its promoter region contains long and short interspersed repetitive elements suggesting a possible rearrangement or gene conversion. It is unknown whether this gene's encoded protein is involved with natural killer cell differentiation as are its other family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik A T 16: 90,927,426 V136D probably damaging Het
Akap9 T C 5: 3,976,151 S1269P probably benign Het
Aqr T C 2: 114,112,577 T1172A probably benign Het
Art2a-ps A T 7: 101,554,749 L194* probably null Het
Atrn T C 2: 130,982,042 F967S probably damaging Het
Btnl1 A G 17: 34,382,462 D323G probably damaging Het
Cadps C A 14: 12,505,808 C754F probably damaging Het
Ccdc7b A G 8: 129,110,920 T131A probably benign Het
Cic A T 7: 25,272,778 I645L probably benign Het
Clca1 C A 3: 145,016,858 C251F probably damaging Het
Cldn16 A T 16: 26,477,558 T95S probably benign Het
Cntnap4 C T 8: 112,810,710 H738Y probably benign Het
Col8a2 A T 4: 126,311,019 probably benign Het
Corin A T 5: 72,329,699 V706D probably damaging Het
Cuzd1 G A 7: 131,314,800 P310L probably damaging Het
Cyp4a12a T C 4: 115,327,312 F295L probably benign Het
Cyp4a12b T G 4: 115,432,506 M190R probably damaging Het
Dagla A G 19: 10,271,009 Y96H probably damaging Het
Dapp1 T C 3: 137,939,171 Q148R probably benign Het
Dcaf17 T A 2: 71,088,580 S499R probably benign Het
Ddx27 T A 2: 167,019,984 D135E probably benign Het
Defb3 A T 8: 19,295,156 I43F possibly damaging Het
Dnajc10 T G 2: 80,347,778 F710V probably damaging Het
Dnhd1 T C 7: 105,678,049 L735P probably damaging Het
Dnmt1 G A 9: 20,926,693 P242S probably benign Het
Dync1h1 G A 12: 110,649,483 D3022N probably benign Het
Ep400 G A 5: 110,753,859 T464I probably damaging Het
Epc1 T C 18: 6,449,138 N453S possibly damaging Het
Eral1 A T 11: 78,078,304 N123K probably damaging Het
Ercc5 G A 1: 44,158,857 V145I probably benign Het
Evc A G 5: 37,323,713 S263P probably damaging Het
Fancc A T 13: 63,347,564 M182K probably benign Het
Fbxl3 G T 14: 103,083,090 A355E probably damaging Het
Fig4 A C 10: 41,188,632 S872A probably damaging Het
Gm14393 C A 2: 175,062,704 probably benign Het
Gm16432 A G 1: 178,122,785 D734G possibly damaging Het
Gm27013 A T 6: 130,521,040 noncoding transcript Het
Gprc5a T A 6: 135,083,452 M313K probably benign Het
H2-T3 T C 17: 36,189,344 probably null Het
Hap1 G A 11: 100,354,724 T138M probably benign Het
Hist1h2ak T C 13: 21,753,712 N39S possibly damaging Het
Hook3 T G 8: 26,032,011 K679T probably damaging Het
Ints2 G T 11: 86,249,275 R244S probably damaging Het
Itgb4 T C 11: 115,993,325 V945A probably damaging Het
Itih2 C T 2: 10,110,400 S387N probably benign Het
Jmjd7 T A 2: 120,032,168 M306K probably benign Het
Kmo T A 1: 175,650,572 M208K probably damaging Het
Kmo G T 1: 175,650,573 M208I possibly damaging Het
Masp2 A G 4: 148,613,901 T480A probably damaging Het
Mogs G T 6: 83,118,638 R812L possibly damaging Het
Mrpl43 A G 19: 45,005,889 I97T possibly damaging Het
Myoz1 A G 14: 20,650,595 W185R probably damaging Het
Ncam2 T A 16: 81,465,569 H303Q probably benign Het
Nufip2 T C 11: 77,741,728 V690A unknown Het
Obox1 A T 7: 15,556,227 N165I possibly damaging Het
Olfr1218 T G 2: 89,055,154 I91L possibly damaging Het
Olfr3 C T 2: 36,812,525 C189Y probably damaging Het
Olfr32 T A 2: 90,138,214 E308D probably benign Het
Olfr781 A G 10: 129,333,273 T131A probably benign Het
Pex1 A G 5: 3,633,885 Y1127C probably damaging Het
Pno1 T C 11: 17,211,438 K24E probably benign Het
Qdpr T A 5: 45,439,327 N165I possibly damaging Het
Robo2 A G 16: 73,961,873 V674A probably damaging Het
Runx1t1 A T 4: 13,889,864 T598S unknown Het
Samd11 A G 4: 156,249,432 L174P probably damaging Het
Scn2a T A 2: 65,743,051 probably null Het
Slc4a1 G T 11: 102,361,419 probably benign Het
Snx25 A T 8: 46,116,437 probably benign Het
Sox2 A G 3: 34,651,044 N210S probably benign Het
Spag6 T C 2: 18,732,147 probably null Het
Speer4b A T 5: 27,498,038 L154Q probably null Het
Stt3a T A 9: 36,741,793 Q531L probably damaging Het
Tcl1 A C 12: 105,217,508 probably benign Het
Trip11 A T 12: 101,883,341 M1488K possibly damaging Het
Ttn T C 2: 76,968,403 H509R probably benign Het
Ulk3 C T 9: 57,594,310 L425F possibly damaging Het
Vmn1r238 T A 18: 3,123,294 K40M probably damaging Het
Vopp1 G A 6: 57,754,548 P153S probably damaging Het
Wdyhv1 A T 15: 58,148,344 I34F probably damaging Het
Zbtb42 C T 12: 112,680,542 R384W probably damaging Het
Zfp14 G T 7: 30,038,916 Q215K probably damaging Het
Zfp473 A T 7: 44,732,952 Y651* probably null Het
Zfp735 G T 11: 73,689,724 E16D possibly damaging Het
Zfp846 G T 9: 20,593,513 C223F probably damaging Het
Other mutations in Klra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Klra2 APN 6 131230217 missense probably benign 0.11
IGL02280:Klra2 APN 6 131245293 missense probably damaging 1.00
IGL02503:Klra2 APN 6 131230094 missense probably benign 0.10
IGL03120:Klra2 APN 6 131220217 missense probably benign 0.00
FR4449:Klra2 UTSW 6 131221846 frame shift probably null
FR4548:Klra2 UTSW 6 131221851 frame shift probably null
FR4737:Klra2 UTSW 6 131221852 frame shift probably null
R0082:Klra2 UTSW 6 131220247 missense possibly damaging 0.90
R0597:Klra2 UTSW 6 131220185 missense probably benign 0.00
R0606:Klra2 UTSW 6 131220224 missense probably damaging 1.00
R0636:Klra2 UTSW 6 131220104 splice site probably benign
R0800:Klra2 UTSW 6 131230174 nonsense probably null
R1645:Klra2 UTSW 6 131243894 critical splice donor site probably null
R1655:Klra2 UTSW 6 131220211 missense probably damaging 0.96
R1950:Klra2 UTSW 6 131230115 missense probably benign 0.02
R2088:Klra2 UTSW 6 131242826 missense probably damaging 0.99
R2402:Klra2 UTSW 6 131243901 missense probably benign 0.01
R3776:Klra2 UTSW 6 131242963 missense probably benign 0.06
R4131:Klra2 UTSW 6 131228217 missense probably benign 0.03
R4570:Klra2 UTSW 6 131243937 missense probably damaging 1.00
R4585:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4884:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R4982:Klra2 UTSW 6 131220189 missense probably benign 0.25
R5043:Klra2 UTSW 6 131220172 missense probably benign 0.06
R5457:Klra2 UTSW 6 131221889 missense possibly damaging 0.92
R6526:Klra2 UTSW 6 131221876 missense probably benign 0.21
R6538:Klra2 UTSW 6 131242990 missense probably damaging 0.99
R7393:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R7785:Klra2 UTSW 6 131245290 missense possibly damaging 0.95
RF020:Klra2 UTSW 6 131221838 frame shift probably null
RF059:Klra2 UTSW 6 131221838 frame shift probably null
RF064:Klra2 UTSW 6 131221839 frame shift probably null
Z1088:Klra2 UTSW 6 131228290 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCACATTGCAGAAACAC -3'
(R):5'- ACAGGGTTCTCTGGGCATTG -3'

Sequencing Primer
(F):5'- ACACAACCCATGAAGGACTC -3'
(R):5'- ACAGGGTTCTCTGGGCATTGTATAAC -3'
Posted On2015-09-24