Incidental Mutation 'R0064:Cdk1'
ID 34413
Institutional Source Beutler Lab
Gene Symbol Cdk1
Ensembl Gene ENSMUSG00000019942
Gene Name cyclin-dependent kinase 1
Synonyms p34, Cdc2, Cdc2a
MMRRC Submission 038356-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0064 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 69335146-69352938 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 69345077 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 101 (D101G)
Ref Sequence ENSEMBL: ENSMUSP00000119085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020099] [ENSMUST00000119827] [ENSMUST00000152448]
AlphaFold P11440
Predicted Effect probably benign
Transcript: ENSMUST00000020099
AA Change: D101G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000020099
Gene: ENSMUSG00000019942
AA Change: D101G

DomainStartEndE-ValueType
S_TKc 4 287 7.87e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119827
AA Change: D101G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113184
Gene: ENSMUSG00000019942
AA Change: D101G

DomainStartEndE-ValueType
S_TKc 4 287 7.87e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149474
Predicted Effect probably benign
Transcript: ENSMUST00000152448
AA Change: D101G

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119085
Gene: ENSMUSG00000019942
AA Change: D101G

DomainStartEndE-ValueType
Pfam:Pkinase 4 200 8.7e-65 PFAM
Pfam:Pkinase_Tyr 5 200 6.9e-35 PFAM
Meta Mutation Damage Score 0.1679 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with this protein and function as regulatory subunits. The kinase activity of this protein is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of this protein also play important regulatory roles in cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null allele die prior to E1.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Cdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02343:Cdk1 APN 10 69340501 missense probably benign
IGL02875:Cdk1 APN 10 69342536 splice site probably benign
IGL03295:Cdk1 APN 10 69342543 missense possibly damaging 0.88
R0064:Cdk1 UTSW 10 69345077 missense probably benign 0.34
R0413:Cdk1 UTSW 10 69345099 missense probably benign 0.00
R1635:Cdk1 UTSW 10 69338547 missense probably damaging 1.00
R4173:Cdk1 UTSW 10 69345161 missense probably benign 0.19
R5154:Cdk1 UTSW 10 69340468 unclassified probably benign
R6847:Cdk1 UTSW 10 69338528 missense probably benign
R8222:Cdk1 UTSW 10 69340596 missense probably benign 0.00
R8755:Cdk1 UTSW 10 69340605 missense probably benign 0.02
R9681:Cdk1 UTSW 10 69342619 missense possibly damaging 0.89
RF023:Cdk1 UTSW 10 69340498 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACATAACCACTGTAGCCTGGCCTG -3'
(R):5'- ACTGTCCTGAACTTCCGTCCTCAAG -3'

Sequencing Primer
(F):5'- AGGTGCTCAGACGCTACTTC -3'
(R):5'- CAAGTTCTACTTGAGAGTGAAGGTC -3'
Posted On 2013-05-09