Mutagenetix > Incidental Mutation

Incidental Mutation 'R4586:Ints2'

344130

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

041807-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4586 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 86249275 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 244 (R244S)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000139285]

AlphaFold

Q80UK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000018212
AA Change: R244S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: R244S

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108039
AA Change: R244S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: R244S

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

probably benign
Transcript: ENSMUST00000139285

SMART Domains

Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	190	1.4e-69	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Meta Mutation Damage Score

0.1452

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	A	T	16: 90,927,426	V136D	probably damaging	Het
Akap9	T	C	5: 3,976,151	S1269P	probably benign	Het
Aqr	T	C	2: 114,112,577	T1172A	probably benign	Het
Art2a-ps	A	T	7: 101,554,749	L194*	probably null	Het
Atrn	T	C	2: 130,982,042	F967S	probably damaging	Het
Btnl1	A	G	17: 34,382,462	D323G	probably damaging	Het
Cadps	C	A	14: 12,505,808	C754F	probably damaging	Het
Ccdc7b	A	G	8: 129,110,920	T131A	probably benign	Het
Cic	A	T	7: 25,272,778	I645L	probably benign	Het
Clca1	C	A	3: 145,016,858	C251F	probably damaging	Het
Cldn16	A	T	16: 26,477,558	T95S	probably benign	Het
Cntnap4	C	T	8: 112,810,710	H738Y	probably benign	Het
Col8a2	A	T	4: 126,311,019		probably benign	Het
Corin	A	T	5: 72,329,699	V706D	probably damaging	Het
Cuzd1	G	A	7: 131,314,800	P310L	probably damaging	Het
Cyp4a12a	T	C	4: 115,327,312	F295L	probably benign	Het
Cyp4a12b	T	G	4: 115,432,506	M190R	probably damaging	Het
Dagla	A	G	19: 10,271,009	Y96H	probably damaging	Het
Dapp1	T	C	3: 137,939,171	Q148R	probably benign	Het
Dcaf17	T	A	2: 71,088,580	S499R	probably benign	Het
Ddx27	T	A	2: 167,019,984	D135E	probably benign	Het
Defb3	A	T	8: 19,295,156	I43F	possibly damaging	Het
Dnajc10	T	G	2: 80,347,778	F710V	probably damaging	Het
Dnhd1	T	C	7: 105,678,049	L735P	probably damaging	Het
Dnmt1	G	A	9: 20,926,693	P242S	probably benign	Het
Dync1h1	G	A	12: 110,649,483	D3022N	probably benign	Het
Ep400	G	A	5: 110,753,859	T464I	probably damaging	Het
Epc1	T	C	18: 6,449,138	N453S	possibly damaging	Het
Eral1	A	T	11: 78,078,304	N123K	probably damaging	Het
Ercc5	G	A	1: 44,158,857	V145I	probably benign	Het
Evc	A	G	5: 37,323,713	S263P	probably damaging	Het
Fancc	A	T	13: 63,347,564	M182K	probably benign	Het
Fbxl3	G	T	14: 103,083,090	A355E	probably damaging	Het
Fig4	A	C	10: 41,188,632	S872A	probably damaging	Het
Gm14393	C	A	2: 175,062,704		probably benign	Het
Gm16432	A	G	1: 178,122,785	D734G	possibly damaging	Het
Gm27013	A	T	6: 130,521,040		noncoding transcript	Het
Gprc5a	T	A	6: 135,083,452	M313K	probably benign	Het
H2-T3	T	C	17: 36,189,344		probably null	Het
Hap1	G	A	11: 100,354,724	T138M	probably benign	Het
Hist1h2ak	T	C	13: 21,753,712	N39S	possibly damaging	Het
Hook3	T	G	8: 26,032,011	K679T	probably damaging	Het
Itgb4	T	C	11: 115,993,325	V945A	probably damaging	Het
Itih2	C	T	2: 10,110,400	S387N	probably benign	Het
Jmjd7	T	A	2: 120,032,168	M306K	probably benign	Het
Klra2	T	A	6: 131,230,157	D163V	probably benign	Het
Kmo	T	A	1: 175,650,572	M208K	probably damaging	Het
Kmo	G	T	1: 175,650,573	M208I	possibly damaging	Het
Masp2	A	G	4: 148,613,901	T480A	probably damaging	Het
Mogs	G	T	6: 83,118,638	R812L	possibly damaging	Het
Mrpl43	A	G	19: 45,005,889	I97T	possibly damaging	Het
Myoz1	A	G	14: 20,650,595	W185R	probably damaging	Het
Ncam2	T	A	16: 81,465,569	H303Q	probably benign	Het
Nufip2	T	C	11: 77,741,728	V690A	unknown	Het
Obox1	A	T	7: 15,556,227	N165I	possibly damaging	Het
Olfr1218	T	G	2: 89,055,154	I91L	possibly damaging	Het
Olfr3	C	T	2: 36,812,525	C189Y	probably damaging	Het
Olfr32	T	A	2: 90,138,214	E308D	probably benign	Het
Olfr781	A	G	10: 129,333,273	T131A	probably benign	Het
Pex1	A	G	5: 3,633,885	Y1127C	probably damaging	Het
Pno1	T	C	11: 17,211,438	K24E	probably benign	Het
Qdpr	T	A	5: 45,439,327	N165I	possibly damaging	Het
Robo2	A	G	16: 73,961,873	V674A	probably damaging	Het
Runx1t1	A	T	4: 13,889,864	T598S	unknown	Het
Samd11	A	G	4: 156,249,432	L174P	probably damaging	Het
Scn2a	T	A	2: 65,743,051		probably null	Het
Slc4a1	G	T	11: 102,361,419		probably benign	Het
Snx25	A	T	8: 46,116,437		probably benign	Het
Sox2	A	G	3: 34,651,044	N210S	probably benign	Het
Spag6	T	C	2: 18,732,147		probably null	Het
Speer4b	A	T	5: 27,498,038	L154Q	probably null	Het
Stt3a	T	A	9: 36,741,793	Q531L	probably damaging	Het
Tcl1	A	C	12: 105,217,508		probably benign	Het
Trip11	A	T	12: 101,883,341	M1488K	possibly damaging	Het
Ttn	T	C	2: 76,968,403	H509R	probably benign	Het
Ulk3	C	T	9: 57,594,310	L425F	possibly damaging	Het
Vmn1r238	T	A	18: 3,123,294	K40M	probably damaging	Het
Vopp1	G	A	6: 57,754,548	P153S	probably damaging	Het
Wdyhv1	A	T	15: 58,148,344	I34F	probably damaging	Het
Zbtb42	C	T	12: 112,680,542	R384W	probably damaging	Het
Zfp14	G	T	7: 30,038,916	Q215K	probably damaging	Het
Zfp473	A	T	7: 44,732,952	Y651*	probably null	Het
Zfp735	G	T	11: 73,689,724	E16D	possibly damaging	Het
Zfp846	G	T	9: 20,593,513	C223F	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGCAGCATACTCAGGATATG -3'
(R):5'- TGCGAATCCCGTTGACTTGG -3'

Sequencing Primer
(F):5'- CTCAGGATATGAATAAAGTTCCCCG -3'
(R):5'- CAATACTATCAAGTTCCCAGGGTCTG -3'

Posted On

2015-09-24