Incidental Mutation 'R4587:Cd244'
ID344155
Institutional Source Beutler Lab
Gene Symbol Cd244
Ensembl Gene ENSMUSG00000004709
Gene NameCD244 natural killer cell receptor 2B4
Synonyms2B4, C9.1, F730046O15Rik, Nmrk
MMRRC Submission 042006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4587 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171559193-171609746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 171577879 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 277 (D277E)
Ref Sequence ENSEMBL: ENSMUSP00000141898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004829] [ENSMUST00000194797]
Predicted Effect probably benign
Transcript: ENSMUST00000004829
AA Change: D277E

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000004829
Gene: ENSMUSG00000004709
AA Change: D277E

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Blast:IG_like 146 222 8e-19 BLAST
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194170
Predicted Effect probably benign
Transcript: ENSMUST00000194797
AA Change: D277E

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141898
Gene: ENSMUSG00000004709
AA Change: D277E

DomainStartEndE-ValueType
IG 26 128 4.23e-2 SMART
Pfam:Ig_2 134 221 6.5e-5 PFAM
transmembrane domain 226 248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195804
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered natural killer (NK) cell cytolysis. Mice homozygous for an ENU-generated allele exhibit reduced 'missing-self' targets recognition and elimination and increased clearance of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,152 I971T possibly damaging Het
Abhd16a T C 17: 35,101,087 probably null Het
Adsl T C 15: 80,967,767 probably null Het
Arhgap32 T C 9: 32,260,945 S1674P probably benign Het
Ces1a A G 8: 93,025,304 Y401H probably damaging Het
Chd9 G T 8: 91,036,506 V2320F possibly damaging Het
Chrd A G 16: 20,738,575 E670G possibly damaging Het
Ckap2 A G 8: 22,176,976 S290P probably benign Het
Cluap1 T A 16: 3,933,816 probably null Het
Col15a1 C T 4: 47,257,184 T325M probably damaging Het
Dnah5 T C 15: 28,304,599 F1652S probably damaging Het
Dok6 T C 18: 89,301,196 Q312R probably benign Het
Glis1 C A 4: 107,627,543 H600N possibly damaging Het
Gm5155 C T 7: 17,886,224 L18F possibly damaging Het
Hivep1 A G 13: 42,156,228 D648G probably benign Het
Kif22 A T 7: 127,032,880 probably null Het
Lmtk3 A G 7: 45,794,080 D729G possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Nf1 T A 11: 79,536,037 probably null Het
Nom1 T C 5: 29,451,165 S843P possibly damaging Het
Olfr393 A G 11: 73,847,219 I302T probably benign Het
Pex14 A G 4: 148,963,564 probably benign Het
Ptcd1 T C 5: 145,154,721 T523A possibly damaging Het
Rasip1 T C 7: 45,632,735 V554A possibly damaging Het
Ric3 A T 7: 109,054,363 probably null Het
Skint4 G A 4: 112,087,024 C11Y probably damaging Het
Smr2 G A 5: 88,108,772 R103H probably benign Het
Sobp T C 10: 43,158,024 Y102C probably damaging Het
Taar7f T A 10: 24,050,575 F356I probably damaging Het
Tbcd T C 11: 121,605,271 V1044A possibly damaging Het
Tecpr1 C G 5: 144,212,590 V340L probably damaging Het
Tle3 A G 9: 61,374,013 I22V probably damaging Het
Trim30a G A 7: 104,435,644 R120* probably null Het
Trim72 A G 7: 128,007,992 D231G probably benign Het
Vmn2r59 T A 7: 42,046,224 N255Y probably benign Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Wnt7a A T 6: 91,366,342 probably null Het
Zfp51 C T 17: 21,464,916 Q598* probably null Het
Zfp617 A T 8: 71,929,159 N51I probably damaging Het
Zfp977 A T 7: 42,580,190 C304S probably damaging Het
Zic1 A G 9: 91,364,822 S66P probably damaging Het
Other mutations in Cd244
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Cd244 APN 1 171574370 critical splice donor site probably null
IGL01014:Cd244 APN 1 171574288 missense probably damaging 1.00
IGL01689:Cd244 APN 1 171582894 intron probably benign
IGL02327:Cd244 APN 1 171559341 missense probably benign 0.36
R0022:Cd244 UTSW 1 171573762 missense probably benign 0.03
R0930:Cd244 UTSW 1 171577233 splice site probably null
R1055:Cd244 UTSW 1 171577276 missense probably damaging 0.99
R5517:Cd244 UTSW 1 171577974 splice site probably benign
R5929:Cd244 UTSW 1 171559367 missense probably damaging 1.00
R5996:Cd244 UTSW 1 171581640 splice site probably null
R6346:Cd244 UTSW 1 171577321 missense probably damaging 1.00
R6502:Cd244 UTSW 1 171577879 missense probably benign 0.05
R6612:Cd244 UTSW 1 171574104 missense probably benign 0.05
R6701:Cd244 UTSW 1 171574155 missense possibly damaging 0.67
R6973:Cd244 UTSW 1 171574207 missense probably damaging 1.00
R7655:Cd244 UTSW 1 171577255 missense probably damaging 1.00
R7656:Cd244 UTSW 1 171577255 missense probably damaging 1.00
R7672:Cd244 UTSW 1 171577285 missense probably benign 0.28
R7769:Cd244 UTSW 1 171577305 missense probably benign 0.24
RF004:Cd244 UTSW 1 171577922 missense probably benign 0.15
Z1177:Cd244 UTSW 1 171574350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAACCTGCCTGTTTTCTAGAGCC -3'
(R):5'- AGTACAGCACCATGTGACCC -3'

Sequencing Primer
(F):5'- TGGAATCCTGGGTAGGAA -3'
(R):5'- AGCACCATGTGACCCCTTCTG -3'
Posted On2015-09-24