Incidental Mutation 'R4587:Smr2'
ID344161
Institutional Source Beutler Lab
Gene Symbol Smr2
Ensembl Gene ENSMUSG00000029281
Gene Namesubmaxillary gland androgen regulated protein 2
SynonymsMSG2
MMRRC Submission 042006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4587 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location88086556-88109053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88108772 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 103 (R103H)
Ref Sequence ENSEMBL: ENSMUSP00000142688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087043] [ENSMUST00000113257] [ENSMUST00000196070] [ENSMUST00000196477]
Predicted Effect unknown
Transcript: ENSMUST00000087043
AA Change: R103H
SMART Domains Protein: ENSMUSP00000084271
Gene: ENSMUSG00000029281
AA Change: R103H

DomainStartEndE-ValueType
Pfam:PROL5-SMR 1 120 8.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113257
Predicted Effect probably benign
Transcript: ENSMUST00000196070
AA Change: R103H

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000143443
Gene: ENSMUSG00000029281
AA Change: R103H

DomainStartEndE-ValueType
Pfam:PROL5-SMR 1 115 9.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196477
AA Change: R103H

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142688
Gene: ENSMUSG00000029281
AA Change: R103H

DomainStartEndE-ValueType
Pfam:PROL5-SMR 1 115 9.4e-41 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,152 I971T possibly damaging Het
Abhd16a T C 17: 35,101,087 probably null Het
Adsl T C 15: 80,967,767 probably null Het
Arhgap32 T C 9: 32,260,945 S1674P probably benign Het
Cd244 T G 1: 171,577,879 D277E probably benign Het
Ces1a A G 8: 93,025,304 Y401H probably damaging Het
Chd9 G T 8: 91,036,506 V2320F possibly damaging Het
Chrd A G 16: 20,738,575 E670G possibly damaging Het
Ckap2 A G 8: 22,176,976 S290P probably benign Het
Cluap1 T A 16: 3,933,816 probably null Het
Col15a1 C T 4: 47,257,184 T325M probably damaging Het
Dnah5 T C 15: 28,304,599 F1652S probably damaging Het
Dok6 T C 18: 89,301,196 Q312R probably benign Het
Glis1 C A 4: 107,627,543 H600N possibly damaging Het
Gm5155 C T 7: 17,886,224 L18F possibly damaging Het
Hivep1 A G 13: 42,156,228 D648G probably benign Het
Kif22 A T 7: 127,032,880 probably null Het
Lmtk3 A G 7: 45,794,080 D729G possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Nf1 T A 11: 79,536,037 probably null Het
Nom1 T C 5: 29,451,165 S843P possibly damaging Het
Olfr393 A G 11: 73,847,219 I302T probably benign Het
Pex14 A G 4: 148,963,564 probably benign Het
Ptcd1 T C 5: 145,154,721 T523A possibly damaging Het
Rasip1 T C 7: 45,632,735 V554A possibly damaging Het
Ric3 A T 7: 109,054,363 probably null Het
Skint4 G A 4: 112,087,024 C11Y probably damaging Het
Sobp T C 10: 43,158,024 Y102C probably damaging Het
Taar7f T A 10: 24,050,575 F356I probably damaging Het
Tbcd T C 11: 121,605,271 V1044A possibly damaging Het
Tecpr1 C G 5: 144,212,590 V340L probably damaging Het
Tle3 A G 9: 61,374,013 I22V probably damaging Het
Trim30a G A 7: 104,435,644 R120* probably null Het
Trim72 A G 7: 128,007,992 D231G probably benign Het
Vmn2r59 T A 7: 42,046,224 N255Y probably benign Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Wnt7a A T 6: 91,366,342 probably null Het
Zfp51 C T 17: 21,464,916 Q598* probably null Het
Zfp617 A T 8: 71,929,159 N51I probably damaging Het
Zfp977 A T 7: 42,580,190 C304S probably damaging Het
Zic1 A G 9: 91,364,822 S66P probably damaging Het
Other mutations in Smr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Smr2 APN 5 88108519 missense probably damaging 0.97
IGL02903:Smr2 APN 5 88108630 missense probably benign 0.03
IGL02952:Smr2 APN 5 88088236 missense possibly damaging 0.71
IGL03245:Smr2 APN 5 88108850 missense probably benign 0.01
R0832:Smr2 UTSW 5 88108824 frame shift probably null
R1328:Smr2 UTSW 5 88108824 frame shift probably null
R1575:Smr2 UTSW 5 88108824 frame shift probably null
R1950:Smr2 UTSW 5 88108824 frame shift probably null
R1950:Smr2 UTSW 5 88108826 frame shift probably null
R2102:Smr2 UTSW 5 88108736 missense probably damaging 0.96
R3616:Smr2 UTSW 5 88108824 frame shift probably null
R4806:Smr2 UTSW 5 88098430 nonsense probably null
R5809:Smr2 UTSW 5 88108840 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAGAGGACAGCATGATCCTACAAG -3'
(R):5'- CTCACAAAATTCTACAGAGGTTTGG -3'

Sequencing Primer
(F):5'- GATCCTACAAGACCACTATCTCCTTC -3'
(R):5'- GGGCAGTAGCAGTAGTTA -3'
Posted On2015-09-24