Incidental Mutation 'R4587:Gm5155'
ID344165
Institutional Source Beutler Lab
Gene Symbol Gm5155
Ensembl Gene ENSMUSG00000078793
Gene Namepredicted gene 5155
Synonyms
MMRRC Submission 042006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4587 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location17871768-17919024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17886224 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 18 (L18F)
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072381
SMART Domains Protein: ENSMUSP00000072218
Gene: ENSMUSG00000078793

DomainStartEndE-ValueType
IG 40 141 2.27e-2 SMART
IG_like 160 261 2.73e1 SMART
IG_like 277 378 6.69e0 SMART
IG_like 397 498 4.07e1 SMART
IG_like 514 615 6.52e0 SMART
IG_like 634 735 1.05e1 SMART
IG 753 853 1.28e-1 SMART
IGc2 869 933 3.82e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165490
AA Change: L18F

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130117
Gene: ENSMUSG00000078793
AA Change: L18F

DomainStartEndE-ValueType
IG 40 141 2.94e-1 SMART
IG_like 160 261 2.73e1 SMART
IG_like 277 378 6.69e0 SMART
IG_like 397 498 4.07e1 SMART
IG_like 514 615 6.52e0 SMART
IG_like 634 735 1.05e1 SMART
IG 753 853 1.28e-1 SMART
IGc2 869 933 3.82e-9 SMART
Meta Mutation Damage Score 0.2579 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,152 I971T possibly damaging Het
Abhd16a T C 17: 35,101,087 probably null Het
Adsl T C 15: 80,967,767 probably null Het
Arhgap32 T C 9: 32,260,945 S1674P probably benign Het
Cd244 T G 1: 171,577,879 D277E probably benign Het
Ces1a A G 8: 93,025,304 Y401H probably damaging Het
Chd9 G T 8: 91,036,506 V2320F possibly damaging Het
Chrd A G 16: 20,738,575 E670G possibly damaging Het
Ckap2 A G 8: 22,176,976 S290P probably benign Het
Cluap1 T A 16: 3,933,816 probably null Het
Col15a1 C T 4: 47,257,184 T325M probably damaging Het
Dnah5 T C 15: 28,304,599 F1652S probably damaging Het
Dok6 T C 18: 89,301,196 Q312R probably benign Het
Glis1 C A 4: 107,627,543 H600N possibly damaging Het
Hivep1 A G 13: 42,156,228 D648G probably benign Het
Kif22 A T 7: 127,032,880 probably null Het
Lmtk3 A G 7: 45,794,080 D729G possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Nf1 T A 11: 79,536,037 probably null Het
Nom1 T C 5: 29,451,165 S843P possibly damaging Het
Olfr393 A G 11: 73,847,219 I302T probably benign Het
Pex14 A G 4: 148,963,564 probably benign Het
Ptcd1 T C 5: 145,154,721 T523A possibly damaging Het
Rasip1 T C 7: 45,632,735 V554A possibly damaging Het
Ric3 A T 7: 109,054,363 probably null Het
Skint4 G A 4: 112,087,024 C11Y probably damaging Het
Smr2 G A 5: 88,108,772 R103H probably benign Het
Sobp T C 10: 43,158,024 Y102C probably damaging Het
Taar7f T A 10: 24,050,575 F356I probably damaging Het
Tbcd T C 11: 121,605,271 V1044A possibly damaging Het
Tecpr1 C G 5: 144,212,590 V340L probably damaging Het
Tle3 A G 9: 61,374,013 I22V probably damaging Het
Trim30a G A 7: 104,435,644 R120* probably null Het
Trim72 A G 7: 128,007,992 D231G probably benign Het
Vmn2r59 T A 7: 42,046,224 N255Y probably benign Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Wnt7a A T 6: 91,366,342 probably null Het
Zfp51 C T 17: 21,464,916 Q598* probably null Het
Zfp617 A T 8: 71,929,159 N51I probably damaging Het
Zfp977 A T 7: 42,580,190 C304S probably damaging Het
Zic1 A G 9: 91,364,822 S66P probably damaging Het
Other mutations in Gm5155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Gm5155 APN 7 17910697 missense probably benign 0.32
IGL01085:Gm5155 APN 7 17915691 missense possibly damaging 0.71
IGL01135:Gm5155 APN 7 17902471 exon noncoding transcript
IGL01291:Gm5155 APN 7 17905116 exon noncoding transcript
IGL02252:Gm5155 APN 7 17910532 missense possibly damaging 0.93
IGL03243:Gm5155 APN 7 17918649 exon noncoding transcript
R0113:Gm5155 UTSW 7 17908948 exon noncoding transcript
R0833:Gm5155 UTSW 7 17904981 missense possibly damaging 0.95
R0836:Gm5155 UTSW 7 17904981 missense possibly damaging 0.95
R1462:Gm5155 UTSW 7 17915591 exon noncoding transcript
R1473:Gm5155 UTSW 7 17905091 exon noncoding transcript
R1817:Gm5155 UTSW 7 17873330 exon noncoding transcript
R1905:Gm5155 UTSW 7 17873552 exon noncoding transcript
R2362:Gm5155 UTSW 7 17902473 exon noncoding transcript
R3721:Gm5155 UTSW 7 17902738 missense probably benign 0.41
R4305:Gm5155 UTSW 7 17905193 missense probably benign 0.19
R4567:Gm5155 UTSW 7 17908966 missense probably damaging 0.97
R4691:Gm5155 UTSW 7 17908966 missense possibly damaging 0.93
R4989:Gm5155 UTSW 7 17905218 splice site probably null
R5023:Gm5155 UTSW 7 17902706 missense probably damaging 1.00
R5024:Gm5155 UTSW 7 17910682 missense probably benign 0.06
R5274:Gm5155 UTSW 7 17915717 splice site probably null
R5279:Gm5155 UTSW 7 17873289 splice site noncoding transcript
R5304:Gm5155 UTSW 7 17902692 missense probably benign 0.06
R5312:Gm5155 UTSW 7 17909142 missense probably damaging 1.00
R5899:Gm5155 UTSW 7 17917444 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCACAGCCCATTGGATTCTG -3'
(R):5'- GTTGGGGATTTTCACATTCCTC -3'

Sequencing Primer
(F):5'- CAGCCCATTGGATTCTGGAAAGTG -3'
(R):5'- TGTCTCCTGAGAGCTTCTGACTG -3'
Posted On2015-09-24