Incidental Mutation 'R4587:Kif22'
ID344172
Institutional Source Beutler Lab
Gene Symbol Kif22
Ensembl Gene ENSMUSG00000030677
Gene Namekinesin family member 22
SynonymsKid, Kif22a
MMRRC Submission 042006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4587 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127027729-127042471 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 127032880 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032915] [ENSMUST00000205806]
Predicted Effect probably null
Transcript: ENSMUST00000032915
SMART Domains Protein: ENSMUSP00000032915
Gene: ENSMUSG00000030677

DomainStartEndE-ValueType
KISc 36 371 1.12e-140 SMART
low complexity region 399 428 N/A INTRINSIC
coiled coil region 460 496 N/A INTRINSIC
HhH1 597 616 2.16e0 SMART
HhH1 627 646 8.65e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205754
Predicted Effect probably benign
Transcript: ENSMUST00000205806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206924
Meta Mutation Damage Score 0.9482 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin-like protein family. The family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. The C-terminal half of this protein has been shown to bind DNA. Studies with the Xenopus homolog suggests its essential role in metaphase chromosome alignment and maintenance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality prior to implantation due to defective meiosis II and early embryo mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,152 I971T possibly damaging Het
Abhd16a T C 17: 35,101,087 probably null Het
Adsl T C 15: 80,967,767 probably null Het
Arhgap32 T C 9: 32,260,945 S1674P probably benign Het
Cd244 T G 1: 171,577,879 D277E probably benign Het
Ces1a A G 8: 93,025,304 Y401H probably damaging Het
Chd9 G T 8: 91,036,506 V2320F possibly damaging Het
Chrd A G 16: 20,738,575 E670G possibly damaging Het
Ckap2 A G 8: 22,176,976 S290P probably benign Het
Cluap1 T A 16: 3,933,816 probably null Het
Col15a1 C T 4: 47,257,184 T325M probably damaging Het
Dnah5 T C 15: 28,304,599 F1652S probably damaging Het
Dok6 T C 18: 89,301,196 Q312R probably benign Het
Glis1 C A 4: 107,627,543 H600N possibly damaging Het
Gm5155 C T 7: 17,886,224 L18F possibly damaging Het
Hivep1 A G 13: 42,156,228 D648G probably benign Het
Lmtk3 A G 7: 45,794,080 D729G possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Nf1 T A 11: 79,536,037 probably null Het
Nom1 T C 5: 29,451,165 S843P possibly damaging Het
Olfr393 A G 11: 73,847,219 I302T probably benign Het
Pex14 A G 4: 148,963,564 probably benign Het
Ptcd1 T C 5: 145,154,721 T523A possibly damaging Het
Rasip1 T C 7: 45,632,735 V554A possibly damaging Het
Ric3 A T 7: 109,054,363 probably null Het
Skint4 G A 4: 112,087,024 C11Y probably damaging Het
Smr2 G A 5: 88,108,772 R103H probably benign Het
Sobp T C 10: 43,158,024 Y102C probably damaging Het
Taar7f T A 10: 24,050,575 F356I probably damaging Het
Tbcd T C 11: 121,605,271 V1044A possibly damaging Het
Tecpr1 C G 5: 144,212,590 V340L probably damaging Het
Tle3 A G 9: 61,374,013 I22V probably damaging Het
Trim30a G A 7: 104,435,644 R120* probably null Het
Trim72 A G 7: 128,007,992 D231G probably benign Het
Vmn2r59 T A 7: 42,046,224 N255Y probably benign Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Wnt7a A T 6: 91,366,342 probably null Het
Zfp51 C T 17: 21,464,916 Q598* probably null Het
Zfp617 A T 8: 71,929,159 N51I probably damaging Het
Zfp977 A T 7: 42,580,190 C304S probably damaging Het
Zic1 A G 9: 91,364,822 S66P probably damaging Het
Other mutations in Kif22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Kif22 APN 7 127033473 missense probably damaging 0.96
IGL01333:Kif22 APN 7 127034195 missense probably damaging 1.00
R0207:Kif22 UTSW 7 127042400 start codon destroyed probably null 0.73
R0723:Kif22 UTSW 7 127033906 missense probably damaging 1.00
R1118:Kif22 UTSW 7 127032744 missense probably benign
R1521:Kif22 UTSW 7 127027839 missense probably damaging 0.99
R2036:Kif22 UTSW 7 127030954 missense possibly damaging 0.94
R2092:Kif22 UTSW 7 127033630 missense probably damaging 0.99
R3790:Kif22 UTSW 7 127029496 missense probably damaging 1.00
R4667:Kif22 UTSW 7 127033328 missense probably damaging 1.00
R5082:Kif22 UTSW 7 127033377 missense possibly damaging 0.71
R5853:Kif22 UTSW 7 127033367 missense possibly damaging 0.92
R6045:Kif22 UTSW 7 127031078 missense probably benign 0.00
R6175:Kif22 UTSW 7 127031056 missense possibly damaging 0.53
R6195:Kif22 UTSW 7 127028959 missense probably damaging 0.99
R6407:Kif22 UTSW 7 127033203 missense probably damaging 1.00
R6416:Kif22 UTSW 7 127028932 missense possibly damaging 0.95
R6561:Kif22 UTSW 7 127031053 missense probably benign 0.38
R7122:Kif22 UTSW 7 127032978 missense probably benign 0.01
R7644:Kif22 UTSW 7 127032962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGCTCCCAGTTGATTC -3'
(R):5'- GGAGTCTGACCCATACTCTAATTCTC -3'

Sequencing Primer
(F):5'- AGTTGATTCTTCTTCAGGGCC -3'
(R):5'- CACTCCTCAGGACTCTCTGGG -3'
Posted On2015-09-24