Incidental Mutation 'R4587:Trim72'
ID344173
Institutional Source Beutler Lab
Gene Symbol Trim72
Ensembl Gene ENSMUSG00000042828
Gene Nametripartite motif-containing 72
Synonymsmitsugumin 53, MG53
MMRRC Submission 042006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R4587 (G1)
Quality Score209
Status Validated
Chromosome7
Chromosomal Location128003949-128011033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128007992 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 231 (D231G)
Ref Sequence ENSEMBL: ENSMUSP00000101855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081042] [ENSMUST00000106248]
Predicted Effect probably benign
Transcript: ENSMUST00000081042
AA Change: D231G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000079832
Gene: ENSMUSG00000042828
AA Change: D231G

DomainStartEndE-ValueType
RING 14 56 5.14e-7 SMART
BBOX 81 122 3.89e-7 SMART
coiled coil region 135 169 N/A INTRINSIC
coiled coil region 204 232 N/A INTRINSIC
PRY 288 341 6.48e-13 SMART
Pfam:SPRY 342 472 4.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106248
AA Change: D231G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101855
Gene: ENSMUSG00000042828
AA Change: D231G

DomainStartEndE-ValueType
RING 14 56 5.14e-7 SMART
BBOX 81 122 3.89e-7 SMART
coiled coil region 135 169 N/A INTRINSIC
coiled coil region 204 232 N/A INTRINSIC
PRY 288 341 6.48e-13 SMART
Pfam:SPRY 344 465 1.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206216
Meta Mutation Damage Score 0.0777 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice with disruption of this gene display muscle pathologies that develop with age. Mice homozygous for a knock-out allele exhibit enhanced myogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,152 I971T possibly damaging Het
Abhd16a T C 17: 35,101,087 probably null Het
Adsl T C 15: 80,967,767 probably null Het
Arhgap32 T C 9: 32,260,945 S1674P probably benign Het
Cd244 T G 1: 171,577,879 D277E probably benign Het
Ces1a A G 8: 93,025,304 Y401H probably damaging Het
Chd9 G T 8: 91,036,506 V2320F possibly damaging Het
Chrd A G 16: 20,738,575 E670G possibly damaging Het
Ckap2 A G 8: 22,176,976 S290P probably benign Het
Cluap1 T A 16: 3,933,816 probably null Het
Col15a1 C T 4: 47,257,184 T325M probably damaging Het
Dnah5 T C 15: 28,304,599 F1652S probably damaging Het
Dok6 T C 18: 89,301,196 Q312R probably benign Het
Glis1 C A 4: 107,627,543 H600N possibly damaging Het
Gm5155 C T 7: 17,886,224 L18F possibly damaging Het
Hivep1 A G 13: 42,156,228 D648G probably benign Het
Kif22 A T 7: 127,032,880 probably null Het
Lmtk3 A G 7: 45,794,080 D729G possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Nf1 T A 11: 79,536,037 probably null Het
Nom1 T C 5: 29,451,165 S843P possibly damaging Het
Olfr393 A G 11: 73,847,219 I302T probably benign Het
Pex14 A G 4: 148,963,564 probably benign Het
Ptcd1 T C 5: 145,154,721 T523A possibly damaging Het
Rasip1 T C 7: 45,632,735 V554A possibly damaging Het
Ric3 A T 7: 109,054,363 probably null Het
Skint4 G A 4: 112,087,024 C11Y probably damaging Het
Smr2 G A 5: 88,108,772 R103H probably benign Het
Sobp T C 10: 43,158,024 Y102C probably damaging Het
Taar7f T A 10: 24,050,575 F356I probably damaging Het
Tbcd T C 11: 121,605,271 V1044A possibly damaging Het
Tecpr1 C G 5: 144,212,590 V340L probably damaging Het
Tle3 A G 9: 61,374,013 I22V probably damaging Het
Trim30a G A 7: 104,435,644 R120* probably null Het
Vmn2r59 T A 7: 42,046,224 N255Y probably benign Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Wnt7a A T 6: 91,366,342 probably null Het
Zfp51 C T 17: 21,464,916 Q598* probably null Het
Zfp617 A T 8: 71,929,159 N51I probably damaging Het
Zfp977 A T 7: 42,580,190 C304S probably damaging Het
Zic1 A G 9: 91,364,822 S66P probably damaging Het
Other mutations in Trim72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Trim72 APN 7 128007964 missense probably damaging 0.97
IGL02538:Trim72 APN 7 128004770 missense probably damaging 1.00
IGL02794:Trim72 APN 7 128004532 missense probably damaging 1.00
IGL03077:Trim72 APN 7 128007841 missense probably benign
H8786:Trim72 UTSW 7 128004791 missense probably damaging 0.99
R1101:Trim72 UTSW 7 128010247 missense possibly damaging 0.94
R1711:Trim72 UTSW 7 128004585 missense probably damaging 1.00
R1826:Trim72 UTSW 7 128007844 missense possibly damaging 0.59
R1853:Trim72 UTSW 7 128009082 missense probably benign 0.01
R1854:Trim72 UTSW 7 128009082 missense probably benign 0.01
R2513:Trim72 UTSW 7 128004706 missense possibly damaging 0.93
R4163:Trim72 UTSW 7 128007908 missense probably benign 0.05
R5027:Trim72 UTSW 7 128007965 missense probably damaging 0.99
R5067:Trim72 UTSW 7 128009967 missense possibly damaging 0.86
R5276:Trim72 UTSW 7 128004542 missense probably damaging 1.00
R5290:Trim72 UTSW 7 128010004 missense probably benign 0.03
R5339:Trim72 UTSW 7 128010333 missense probably benign
R5410:Trim72 UTSW 7 128009923 missense probably damaging 1.00
R6301:Trim72 UTSW 7 128004614 missense possibly damaging 0.93
R6594:Trim72 UTSW 7 128010048 missense probably damaging 1.00
R6774:Trim72 UTSW 7 128010386 missense probably damaging 1.00
R7162:Trim72 UTSW 7 128007649 missense probably benign 0.18
R7372:Trim72 UTSW 7 128004686 missense possibly damaging 0.63
R7937:Trim72 UTSW 7 128010319 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCAAGAGTCTTCTCATCCCCAC -3'
(R):5'- TCTGAACCACAGTCAGAGTACC -3'

Sequencing Primer
(F):5'- AGACAGTGCGCCAGTTC -3'
(R):5'- CAACACTGATATGAAGTCCTAGCTTG -3'
Posted On2015-09-24