Incidental Mutation 'R4587:Arhgap32'
ID 344178
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene Name Rho GTPase activating protein 32
Synonyms p200RhoGAP, Grit, PX-RICS, GC-GAP, 3426406O18Rik
MMRRC Submission 042006-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4587 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 32027432-32179742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 32172241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1674 (S1674P)
Ref Sequence ENSEMBL: ENSMUSP00000138145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]
AlphaFold Q811P8
Predicted Effect probably benign
Transcript: ENSMUST00000168954
AA Change: S1674P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: S1674P

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174641
AA Change: S2023P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: S2023P

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182802
AA Change: S1674P

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: S1674P

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd16a T C 17: 35,320,063 (GRCm39) probably null Het
Adsl T C 15: 80,851,968 (GRCm39) probably null Het
Cd244a T G 1: 171,405,447 (GRCm39) D277E probably benign Het
Ceacam23 C T 7: 17,620,149 (GRCm39) L18F possibly damaging Het
Ces1a A G 8: 93,751,932 (GRCm39) Y401H probably damaging Het
Chd9 G T 8: 91,763,134 (GRCm39) V2320F possibly damaging Het
Chrd A G 16: 20,557,325 (GRCm39) E670G possibly damaging Het
Ckap2 A G 8: 22,666,992 (GRCm39) S290P probably benign Het
Cluap1 T A 16: 3,751,680 (GRCm39) probably null Het
Col15a1 C T 4: 47,257,184 (GRCm39) T325M probably damaging Het
Cplane1 T C 15: 8,230,636 (GRCm39) I971T possibly damaging Het
Dnah5 T C 15: 28,304,745 (GRCm39) F1652S probably damaging Het
Dok6 T C 18: 89,319,320 (GRCm39) Q312R probably benign Het
Glis1 C A 4: 107,484,740 (GRCm39) H600N possibly damaging Het
Hivep1 A G 13: 42,309,704 (GRCm39) D648G probably benign Het
Kif22 A T 7: 126,632,052 (GRCm39) probably null Het
Lmtk3 A G 7: 45,443,504 (GRCm39) D729G possibly damaging Het
Mapk8ip3 G A 17: 25,123,761 (GRCm39) P587L probably damaging Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myt1l A G 12: 29,960,800 (GRCm39) K1038E unknown Het
Nf1 T A 11: 79,426,863 (GRCm39) probably null Het
Nom1 T C 5: 29,656,163 (GRCm39) S843P possibly damaging Het
Or1e33 A G 11: 73,738,045 (GRCm39) I302T probably benign Het
Pex14 A G 4: 149,048,021 (GRCm39) probably benign Het
Ptcd1 T C 5: 145,091,531 (GRCm39) T523A possibly damaging Het
Rasip1 T C 7: 45,282,159 (GRCm39) V554A possibly damaging Het
Ric3 A T 7: 108,653,570 (GRCm39) probably null Het
Skint4 G A 4: 111,944,221 (GRCm39) C11Y probably damaging Het
Smr2 G A 5: 88,256,631 (GRCm39) R103H probably benign Het
Sobp T C 10: 43,034,020 (GRCm39) Y102C probably damaging Het
Taar7f T A 10: 23,926,473 (GRCm39) F356I probably damaging Het
Tbcd T C 11: 121,496,097 (GRCm39) V1044A possibly damaging Het
Tecpr1 C G 5: 144,149,408 (GRCm39) V340L probably damaging Het
Tle3 A G 9: 61,281,295 (GRCm39) I22V probably damaging Het
Trim30a G A 7: 104,084,851 (GRCm39) R120* probably null Het
Trim72 A G 7: 127,607,164 (GRCm39) D231G probably benign Het
Vmn2r59 T A 7: 41,695,648 (GRCm39) N255Y probably benign Het
Vps13a T C 19: 16,617,403 (GRCm39) T3002A probably damaging Het
Wnt7a A T 6: 91,343,324 (GRCm39) probably null Het
Zfp51 C T 17: 21,685,178 (GRCm39) Q598* probably null Het
Zfp617 A T 8: 72,683,003 (GRCm39) N51I probably damaging Het
Zfp977 A T 7: 42,229,614 (GRCm39) C304S probably damaging Het
Zic1 A G 9: 91,246,875 (GRCm39) S66P probably damaging Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32,168,657 (GRCm39) missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32,168,260 (GRCm39) missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32,171,801 (GRCm39) missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32,158,486 (GRCm39) missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32,170,627 (GRCm39) missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32,166,944 (GRCm39) missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32,158,490 (GRCm39) missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32,157,302 (GRCm39) missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32,172,431 (GRCm39) missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32,170,430 (GRCm39) missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32,170,816 (GRCm39) missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32,172,152 (GRCm39) missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32,063,294 (GRCm39) missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32,171,056 (GRCm39) missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32,157,773 (GRCm39) missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32,156,551 (GRCm39) critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32,170,199 (GRCm39) missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32,101,364 (GRCm39) splice site probably benign
R0856:Arhgap32 UTSW 9 32,171,516 (GRCm39) missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32,166,677 (GRCm39) missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32,166,608 (GRCm39) missense probably benign
R1455:Arhgap32 UTSW 9 32,171,381 (GRCm39) missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32,027,498 (GRCm39) missense probably benign
R1523:Arhgap32 UTSW 9 32,168,048 (GRCm39) missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32,171,096 (GRCm39) missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32,170,727 (GRCm39) missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32,027,436 (GRCm39) missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32,171,207 (GRCm39) missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32,027,436 (GRCm39) missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32,158,793 (GRCm39) missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32,158,793 (GRCm39) missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32,150,694 (GRCm39) missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32,063,315 (GRCm39) splice site probably null
R3793:Arhgap32 UTSW 9 32,166,669 (GRCm39) missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32,101,320 (GRCm39) missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32,158,362 (GRCm39) unclassified probably benign
R4177:Arhgap32 UTSW 9 32,158,510 (GRCm39) missense probably null 1.00
R4230:Arhgap32 UTSW 9 32,168,770 (GRCm39) missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32,171,185 (GRCm39) missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32,093,135 (GRCm39) splice site probably null
R4612:Arhgap32 UTSW 9 32,170,775 (GRCm39) missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32,150,644 (GRCm39) missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32,081,441 (GRCm39) missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32,172,076 (GRCm39) missense probably damaging 1.00
R4784:Arhgap32 UTSW 9 32,040,949 (GRCm39) missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32,172,076 (GRCm39) missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32,040,949 (GRCm39) missense probably damaging 0.99
R4906:Arhgap32 UTSW 9 32,156,552 (GRCm39) critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32,168,095 (GRCm39) missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32,170,967 (GRCm39) missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32,063,306 (GRCm39) missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32,159,678 (GRCm39) missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32,158,502 (GRCm39) missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32,093,256 (GRCm39) missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32,167,084 (GRCm39) missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32,168,275 (GRCm39) missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32,171,407 (GRCm39) missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32,159,784 (GRCm39) missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32,063,983 (GRCm39) missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32,157,272 (GRCm39) missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32,063,232 (GRCm39) missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32,097,679 (GRCm39) missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32,119,481 (GRCm39) missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32,063,993 (GRCm39) missense
R7289:Arhgap32 UTSW 9 32,168,234 (GRCm39) missense probably benign 0.02
R7289:Arhgap32 UTSW 9 32,168,233 (GRCm39) missense possibly damaging 0.92
R7391:Arhgap32 UTSW 9 32,093,235 (GRCm39) missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32,157,220 (GRCm39) missense probably benign 0.06
R7566:Arhgap32 UTSW 9 32,162,018 (GRCm39) missense probably benign 0.10
R7584:Arhgap32 UTSW 9 32,168,263 (GRCm39) missense probably benign 0.16
R7653:Arhgap32 UTSW 9 32,168,441 (GRCm39) missense probably benign
R7884:Arhgap32 UTSW 9 32,171,810 (GRCm39) missense possibly damaging 0.87
R8087:Arhgap32 UTSW 9 32,168,324 (GRCm39) missense probably benign 0.00
R8109:Arhgap32 UTSW 9 32,093,150 (GRCm39) missense probably benign 0.09
R8131:Arhgap32 UTSW 9 32,158,426 (GRCm39) missense probably damaging 1.00
R8155:Arhgap32 UTSW 9 32,093,196 (GRCm39) missense probably damaging 1.00
R8232:Arhgap32 UTSW 9 32,168,198 (GRCm39) missense probably damaging 1.00
R8303:Arhgap32 UTSW 9 32,172,205 (GRCm39) missense probably benign 0.00
R8304:Arhgap32 UTSW 9 32,167,233 (GRCm39) nonsense probably null
R8696:Arhgap32 UTSW 9 32,159,799 (GRCm39) missense possibly damaging 0.90
R8832:Arhgap32 UTSW 9 32,172,115 (GRCm39) missense possibly damaging 0.94
R9112:Arhgap32 UTSW 9 32,157,309 (GRCm39) missense probably damaging 0.99
R9170:Arhgap32 UTSW 9 32,162,039 (GRCm39) missense possibly damaging 0.47
R9279:Arhgap32 UTSW 9 32,168,655 (GRCm39) missense probably benign 0.01
R9431:Arhgap32 UTSW 9 32,170,463 (GRCm39) missense probably damaging 1.00
R9522:Arhgap32 UTSW 9 32,027,450 (GRCm39) missense probably benign
R9526:Arhgap32 UTSW 9 32,172,026 (GRCm39) missense probably benign 0.28
R9661:Arhgap32 UTSW 9 32,168,531 (GRCm39) missense probably benign 0.01
X0027:Arhgap32 UTSW 9 32,161,937 (GRCm39) critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32,172,365 (GRCm39) missense probably damaging 1.00
Z1177:Arhgap32 UTSW 9 32,171,976 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGATCTGGACAGACCTCGAG -3'
(R):5'- GTGGCAAGGACAACTCTGTG -3'

Sequencing Primer
(F):5'- TGGCCCTGAGAAACACTCCAG -3'
(R):5'- GGACAACTCTGTGGGCAG -3'
Posted On 2015-09-24