Incidental Mutation 'R0064:Myo18a'
ID 34418
Institutional Source Beutler Lab
Gene Symbol Myo18a
Ensembl Gene ENSMUSG00000000631
Gene Name myosin XVIIIA
Synonyms MyoPDZ
MMRRC Submission 038356-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0064 (G1)
Quality Score 171
Status Validated
Chromosome 11
Chromosomal Location 77654072-77756806 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 77738170 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1704 (R1704L)
Ref Sequence ENSEMBL: ENSMUSP00000130696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000645] [ENSMUST00000092884] [ENSMUST00000092887] [ENSMUST00000100794] [ENSMUST00000102488] [ENSMUST00000108375] [ENSMUST00000108376] [ENSMUST00000130305] [ENSMUST00000168348] [ENSMUST00000130627] [ENSMUST00000169105] [ENSMUST00000164334] [ENSMUST00000167856] [ENSMUST00000172303]
AlphaFold Q9JMH9
Predicted Effect probably damaging
Transcript: ENSMUST00000000645
AA Change: R1657L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000645
Gene: ENSMUSG00000000631
AA Change: R1657L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1183 1.53e-45 SMART
IQ 1184 1206 1.11e-3 SMART
Pfam:Myosin_tail_1 1219 1867 1.7e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092884
AA Change: R1325L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090560
Gene: ENSMUSG00000000631
AA Change: R1325L

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1534 2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092887
AA Change: R1656L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090563
Gene: ENSMUSG00000000631
AA Change: R1656L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100443
Predicted Effect probably damaging
Transcript: ENSMUST00000100794
AA Change: R1321L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098358
Gene: ENSMUSG00000000631
AA Change: R1321L

DomainStartEndE-ValueType
MYSc 68 847 1.45e-46 SMART
IQ 848 870 1.11e-3 SMART
Pfam:Myosin_tail_1 884 1530 4.9e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102488
AA Change: R1656L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099546
Gene: ENSMUSG00000000631
AA Change: R1656L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108375
AA Change: R1656L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104012
Gene: ENSMUSG00000000631
AA Change: R1656L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1838 6.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108376
AA Change: R1619L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104013
Gene: ENSMUSG00000000631
AA Change: R1619L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Blast:MYSc 1258 1387 1e-14 BLAST
low complexity region 1396 1407 N/A INTRINSIC
low complexity region 1743 1762 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130305
AA Change: R1337L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119574
Gene: ENSMUSG00000000631
AA Change: R1337L

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168348
AA Change: R1704L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130696
Gene: ENSMUSG00000000631
AA Change: R1704L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 447 1230 4.16e-47 SMART
IQ 1231 1253 1.11e-3 SMART
Blast:MYSc 1306 1435 1e-14 BLAST
low complexity region 1444 1455 N/A INTRINSIC
low complexity region 1828 1847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130627
AA Change: R1668L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119839
Gene: ENSMUSG00000000631
AA Change: R1668L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1850 6.9e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169105
AA Change: R1668L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132149
Gene: ENSMUSG00000000631
AA Change: R1668L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1878 7.3e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164334
AA Change: R1325L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131771
Gene: ENSMUSG00000000631
AA Change: R1325L

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1505 4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167856
AA Change: R1263L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128487
Gene: ENSMUSG00000000631
AA Change: R1263L

DomainStartEndE-ValueType
MYSc 16 789 1.3e-32 SMART
IQ 790 812 1.11e-3 SMART
Blast:MYSc 865 994 1e-14 BLAST
low complexity region 1003 1014 N/A INTRINSIC
low complexity region 1387 1406 N/A INTRINSIC
internal_repeat_1 1569 1627 2.13e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000172303
AA Change: R1343L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129098
Gene: ENSMUSG00000000631
AA Change: R1343L

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135045
Meta Mutation Damage Score 0.3357 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can bind GOLPH3, linking the Golgi to the cytoskeleton and influencing Golgi membrane trafficking. The encoded protein is also part of a complex that assembles lamellar actomyosin bundles and may be required for cell migration. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,035,698 (GRCm39) L641M probably damaging Het
Abca9 A C 11: 110,035,697 (GRCm39) L641R probably damaging Het
Abhd18 A G 3: 40,888,288 (GRCm39) I377M probably benign Het
Arhgef17 C A 7: 100,530,561 (GRCm39) M1408I probably benign Het
Bcl2a1a G C 9: 88,839,516 (GRCm39) G138A probably damaging Het
C4b A G 17: 34,957,830 (GRCm39) L617P probably damaging Het
Ccdc25 T A 14: 66,091,561 (GRCm39) I60K possibly damaging Het
Cdk1 T C 10: 69,180,907 (GRCm39) D101G probably benign Het
Cdon A G 9: 35,400,523 (GRCm39) H1079R probably benign Het
Cep126 A T 9: 8,130,183 (GRCm39) probably benign Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Clstn1 G A 4: 149,719,253 (GRCm39) V361M probably damaging Het
Crlf3 A G 11: 79,948,728 (GRCm39) I239T possibly damaging Het
Cstf2t T A 19: 31,060,699 (GRCm39) N78K probably damaging Het
Cul1 A G 6: 47,479,349 (GRCm39) probably benign Het
D430041D05Rik T G 2: 104,079,502 (GRCm39) T1194P probably damaging Het
Fbp2 A T 13: 63,001,862 (GRCm39) F118I probably damaging Het
Fbxw14 A T 9: 109,116,660 (GRCm39) Y16* probably null Het
Fgd3 T G 13: 49,449,901 (GRCm39) D116A possibly damaging Het
Gm7168 C T 17: 14,170,121 (GRCm39) T496I probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Klhl5 T A 5: 65,298,631 (GRCm39) S137T probably benign Het
Knl1 T A 2: 118,906,724 (GRCm39) N1604K probably benign Het
Lpcat1 T A 13: 73,662,585 (GRCm39) N463K probably damaging Het
Lpl A G 8: 69,345,356 (GRCm39) H120R probably damaging Het
Man1a2 A T 3: 100,499,199 (GRCm39) S412T possibly damaging Het
Mcc C G 18: 44,652,583 (GRCm39) probably benign Het
Nlrc3 G T 16: 3,781,951 (GRCm39) T486K possibly damaging Het
Nrip1 T A 16: 76,091,558 (GRCm39) probably benign Het
Nutf2 A G 8: 106,605,441 (GRCm39) D92G probably damaging Het
Obscn A C 11: 58,918,292 (GRCm39) V6260G probably damaging Het
Or10a2 T C 7: 106,673,487 (GRCm39) F151L probably benign Het
Or2ak7 G A 11: 58,575,301 (GRCm39) V201M probably benign Het
Plce1 T C 19: 38,769,228 (GRCm39) probably null Het
Pmpca C A 2: 26,285,519 (GRCm39) D498E probably benign Het
Pnpla7 G T 2: 24,887,239 (GRCm39) E28* probably null Het
Polg C A 7: 79,111,632 (GRCm39) W206C probably damaging Het
Ptprt C T 2: 161,769,711 (GRCm39) probably benign Het
Slc7a14 T C 3: 31,281,209 (GRCm39) D367G probably damaging Het
Spata31 T C 13: 65,069,912 (GRCm39) Y687H probably damaging Het
Sybu T A 15: 44,536,389 (GRCm39) T646S probably benign Het
Thbs1 A T 2: 117,954,395 (GRCm39) probably null Het
Tie1 A G 4: 118,346,898 (GRCm39) V2A possibly damaging Het
Tma16 A T 8: 66,929,457 (GRCm39) I179K possibly damaging Het
Tns3 G A 11: 8,385,856 (GRCm39) Q1381* probably null Het
Trank1 A G 9: 111,172,263 (GRCm39) D84G probably damaging Het
Ttc3 A T 16: 94,223,106 (GRCm39) H197L possibly damaging Het
Urb1 A G 16: 90,576,028 (GRCm39) F843L probably benign Het
Vmn1r24 T G 6: 57,933,003 (GRCm39) I172L probably benign Het
Vmn2r1 T A 3: 64,012,209 (GRCm39) I690N possibly damaging Het
Vmn2r111 T A 17: 22,791,053 (GRCm39) I82L probably benign Het
Zfp287 A T 11: 62,605,764 (GRCm39) L370H possibly damaging Het
Zfp608 A T 18: 55,031,888 (GRCm39) I684N probably benign Het
Other mutations in Myo18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Myo18a APN 11 77,738,764 (GRCm39) missense probably damaging 1.00
IGL00753:Myo18a APN 11 77,715,977 (GRCm39) missense probably damaging 1.00
IGL01137:Myo18a APN 11 77,718,655 (GRCm39) missense probably damaging 1.00
IGL01536:Myo18a APN 11 77,711,677 (GRCm39) missense probably damaging 1.00
IGL01642:Myo18a APN 11 77,755,558 (GRCm39) missense probably benign 0.07
IGL01728:Myo18a APN 11 77,668,682 (GRCm39) missense probably damaging 0.99
IGL01780:Myo18a APN 11 77,741,073 (GRCm39) missense probably benign 0.02
IGL02286:Myo18a APN 11 77,668,811 (GRCm39) nonsense probably null
IGL02350:Myo18a APN 11 77,741,073 (GRCm39) missense probably benign 0.02
IGL02357:Myo18a APN 11 77,741,073 (GRCm39) missense probably benign 0.02
IGL02420:Myo18a APN 11 77,709,519 (GRCm39) missense possibly damaging 0.81
IGL02643:Myo18a APN 11 77,668,998 (GRCm39) missense possibly damaging 0.67
IGL02667:Myo18a APN 11 77,748,678 (GRCm39) splice site probably benign
IGL02869:Myo18a APN 11 77,720,699 (GRCm39) splice site probably benign
IGL02869:Myo18a APN 11 77,755,612 (GRCm39) missense probably damaging 1.00
IGL02962:Myo18a APN 11 77,669,061 (GRCm39) missense probably damaging 1.00
IGL02963:Myo18a APN 11 77,732,844 (GRCm39) splice site probably benign
IGL03410:Myo18a APN 11 77,738,830 (GRCm39) missense probably damaging 0.99
IGL03050:Myo18a UTSW 11 77,709,596 (GRCm39) missense probably benign 0.00
R0022:Myo18a UTSW 11 77,734,059 (GRCm39) critical splice donor site probably null
R0064:Myo18a UTSW 11 77,738,170 (GRCm39) missense probably damaging 1.00
R0098:Myo18a UTSW 11 77,736,591 (GRCm39) missense probably damaging 1.00
R0322:Myo18a UTSW 11 77,720,626 (GRCm39) missense probably damaging 1.00
R0373:Myo18a UTSW 11 77,711,868 (GRCm39) missense probably benign 0.01
R0379:Myo18a UTSW 11 77,741,632 (GRCm39) missense possibly damaging 0.84
R0513:Myo18a UTSW 11 77,702,420 (GRCm39) intron probably benign
R0688:Myo18a UTSW 11 77,714,966 (GRCm39) missense probably damaging 1.00
R0734:Myo18a UTSW 11 77,738,230 (GRCm39) missense probably damaging 1.00
R0790:Myo18a UTSW 11 77,731,535 (GRCm39) missense possibly damaging 0.95
R1099:Myo18a UTSW 11 77,709,727 (GRCm39) splice site probably null
R1103:Myo18a UTSW 11 77,714,156 (GRCm39) missense probably damaging 1.00
R1183:Myo18a UTSW 11 77,748,571 (GRCm39) missense probably damaging 1.00
R1216:Myo18a UTSW 11 77,709,473 (GRCm39) missense probably benign 0.35
R1331:Myo18a UTSW 11 77,732,405 (GRCm39) missense probably benign 0.28
R1479:Myo18a UTSW 11 77,733,020 (GRCm39) missense probably benign 0.04
R1723:Myo18a UTSW 11 77,744,140 (GRCm39) missense probably damaging 0.97
R1742:Myo18a UTSW 11 77,732,293 (GRCm39) missense probably damaging 0.99
R1796:Myo18a UTSW 11 77,720,170 (GRCm39) missense possibly damaging 0.94
R1823:Myo18a UTSW 11 77,715,923 (GRCm39) splice site probably benign
R1827:Myo18a UTSW 11 77,709,597 (GRCm39) missense probably benign 0.00
R2033:Myo18a UTSW 11 77,733,925 (GRCm39) splice site probably null
R2043:Myo18a UTSW 11 77,714,189 (GRCm39) missense probably damaging 0.99
R2105:Myo18a UTSW 11 77,741,060 (GRCm39) missense probably benign
R2191:Myo18a UTSW 11 77,709,441 (GRCm39) missense probably damaging 0.99
R2264:Myo18a UTSW 11 77,710,798 (GRCm39) splice site probably benign
R2370:Myo18a UTSW 11 77,668,596 (GRCm39) missense probably benign 0.03
R3015:Myo18a UTSW 11 77,749,846 (GRCm39) intron probably benign
R3433:Myo18a UTSW 11 77,708,870 (GRCm39) splice site probably null
R3739:Myo18a UTSW 11 77,736,441 (GRCm39) missense probably damaging 1.00
R3825:Myo18a UTSW 11 77,668,292 (GRCm39) missense possibly damaging 0.47
R4056:Myo18a UTSW 11 77,702,839 (GRCm39) missense possibly damaging 0.72
R4163:Myo18a UTSW 11 77,720,534 (GRCm39) missense possibly damaging 0.72
R4184:Myo18a UTSW 11 77,748,613 (GRCm39) missense probably damaging 1.00
R4620:Myo18a UTSW 11 77,708,773 (GRCm39) missense possibly damaging 0.93
R4628:Myo18a UTSW 11 77,714,962 (GRCm39) missense probably damaging 1.00
R4647:Myo18a UTSW 11 77,708,776 (GRCm39) missense probably damaging 1.00
R4701:Myo18a UTSW 11 77,708,491 (GRCm39) missense probably damaging 1.00
R4729:Myo18a UTSW 11 77,668,511 (GRCm39) splice site probably null
R4731:Myo18a UTSW 11 77,720,585 (GRCm39) missense probably benign 0.00
R4739:Myo18a UTSW 11 77,714,149 (GRCm39) missense probably damaging 1.00
R4814:Myo18a UTSW 11 77,750,062 (GRCm39) intron probably benign
R4889:Myo18a UTSW 11 77,723,238 (GRCm39) missense probably damaging 1.00
R4988:Myo18a UTSW 11 77,736,347 (GRCm39) critical splice donor site probably null
R5172:Myo18a UTSW 11 77,714,924 (GRCm39) missense probably damaging 1.00
R5177:Myo18a UTSW 11 77,755,668 (GRCm39) utr 3 prime probably benign
R5394:Myo18a UTSW 11 77,744,176 (GRCm39) missense probably benign 0.14
R5643:Myo18a UTSW 11 77,745,513 (GRCm39) missense probably benign 0.12
R5808:Myo18a UTSW 11 77,720,127 (GRCm39) missense probably benign 0.34
R5871:Myo18a UTSW 11 77,723,306 (GRCm39) missense probably damaging 1.00
R5936:Myo18a UTSW 11 77,709,039 (GRCm39) missense probably damaging 1.00
R6017:Myo18a UTSW 11 77,732,349 (GRCm39) missense probably damaging 0.96
R6053:Myo18a UTSW 11 77,709,002 (GRCm39) missense probably damaging 1.00
R6271:Myo18a UTSW 11 77,711,635 (GRCm39) missense probably damaging 1.00
R6486:Myo18a UTSW 11 77,755,648 (GRCm39) missense possibly damaging 0.83
R6558:Myo18a UTSW 11 77,741,678 (GRCm39) missense probably damaging 0.99
R6884:Myo18a UTSW 11 77,709,875 (GRCm39) missense possibly damaging 0.67
R6983:Myo18a UTSW 11 77,736,341 (GRCm39) missense probably benign 0.06
R6993:Myo18a UTSW 11 77,749,900 (GRCm39) intron probably benign
R7071:Myo18a UTSW 11 77,714,653 (GRCm39) missense probably damaging 1.00
R7074:Myo18a UTSW 11 77,733,387 (GRCm39) missense probably benign 0.03
R7238:Myo18a UTSW 11 77,733,059 (GRCm39) missense probably damaging 0.96
R7328:Myo18a UTSW 11 77,698,737 (GRCm39) missense
R7527:Myo18a UTSW 11 77,734,406 (GRCm39) missense probably benign 0.00
R7598:Myo18a UTSW 11 77,738,172 (GRCm39) missense probably damaging 1.00
R7671:Myo18a UTSW 11 77,750,246 (GRCm39) missense
R7958:Myo18a UTSW 11 77,732,383 (GRCm39) missense probably damaging 1.00
R8098:Myo18a UTSW 11 77,736,227 (GRCm39) missense probably damaging 0.97
R8168:Myo18a UTSW 11 77,711,968 (GRCm39) missense probably damaging 0.99
R8318:Myo18a UTSW 11 77,714,215 (GRCm39) missense probably benign 0.02
R8685:Myo18a UTSW 11 77,745,520 (GRCm39) missense probably benign 0.00
R8778:Myo18a UTSW 11 77,714,150 (GRCm39) missense probably damaging 1.00
R9023:Myo18a UTSW 11 77,718,477 (GRCm39) missense probably damaging 1.00
R9059:Myo18a UTSW 11 77,668,899 (GRCm39) missense possibly damaging 0.78
R9186:Myo18a UTSW 11 77,749,847 (GRCm39) missense
R9321:Myo18a UTSW 11 77,733,370 (GRCm39) missense probably damaging 0.97
R9357:Myo18a UTSW 11 77,733,014 (GRCm39) missense probably damaging 1.00
R9407:Myo18a UTSW 11 77,709,596 (GRCm39) missense probably benign 0.00
R9430:Myo18a UTSW 11 77,709,410 (GRCm39) missense possibly damaging 0.64
R9576:Myo18a UTSW 11 77,709,827 (GRCm39) missense probably damaging 1.00
R9585:Myo18a UTSW 11 77,709,495 (GRCm39) missense probably benign 0.06
R9698:Myo18a UTSW 11 77,720,681 (GRCm39) missense probably damaging 0.99
R9743:Myo18a UTSW 11 77,723,304 (GRCm39) missense probably benign 0.10
R9777:Myo18a UTSW 11 77,733,080 (GRCm39) missense possibly damaging 0.94
Y5407:Myo18a UTSW 11 77,668,641 (GRCm39) missense probably benign 0.44
Z1177:Myo18a UTSW 11 77,732,821 (GRCm39) missense probably damaging 1.00
Z1187:Myo18a UTSW 11 77,744,643 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCTTTCTCGCTGGGCAGTACAATC -3'
(R):5'- GCCATGCTGTAGGGCATATACAGAC -3'

Sequencing Primer
(F):5'- GGGCAGTACAATCCTGTTATACC -3'
(R):5'- AGTGGCTTGTCCAGACATC -3'
Posted On 2013-05-09