Incidental Mutation 'R0064:Myo18a'
ID 34418
Institutional Source Beutler Lab
Gene Symbol Myo18a
Ensembl Gene ENSMUSG00000000631
Gene Name myosin XVIIIA
Synonyms MyoPDZ
MMRRC Submission 038356-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0064 (G1)
Quality Score 171
Status Validated
Chromosome 11
Chromosomal Location 77763246-77865980 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 77847344 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1704 (R1704L)
Ref Sequence ENSEMBL: ENSMUSP00000130696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000645] [ENSMUST00000092884] [ENSMUST00000092887] [ENSMUST00000100794] [ENSMUST00000102488] [ENSMUST00000108375] [ENSMUST00000108376] [ENSMUST00000130305] [ENSMUST00000130627] [ENSMUST00000164334] [ENSMUST00000167856] [ENSMUST00000168348] [ENSMUST00000169105] [ENSMUST00000172303]
AlphaFold Q9JMH9
Predicted Effect probably damaging
Transcript: ENSMUST00000000645
AA Change: R1657L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000645
Gene: ENSMUSG00000000631
AA Change: R1657L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1183 1.53e-45 SMART
IQ 1184 1206 1.11e-3 SMART
Pfam:Myosin_tail_1 1219 1867 1.7e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092884
AA Change: R1325L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090560
Gene: ENSMUSG00000000631
AA Change: R1325L

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1534 2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092887
AA Change: R1656L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090563
Gene: ENSMUSG00000000631
AA Change: R1656L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100443
Predicted Effect probably damaging
Transcript: ENSMUST00000100794
AA Change: R1321L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098358
Gene: ENSMUSG00000000631
AA Change: R1321L

DomainStartEndE-ValueType
MYSc 68 847 1.45e-46 SMART
IQ 848 870 1.11e-3 SMART
Pfam:Myosin_tail_1 884 1530 4.9e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102488
AA Change: R1656L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099546
Gene: ENSMUSG00000000631
AA Change: R1656L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108375
AA Change: R1656L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104012
Gene: ENSMUSG00000000631
AA Change: R1656L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1838 6.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108376
AA Change: R1619L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104013
Gene: ENSMUSG00000000631
AA Change: R1619L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Blast:MYSc 1258 1387 1e-14 BLAST
low complexity region 1396 1407 N/A INTRINSIC
low complexity region 1743 1762 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130305
AA Change: R1337L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119574
Gene: ENSMUSG00000000631
AA Change: R1337L

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130627
AA Change: R1668L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119839
Gene: ENSMUSG00000000631
AA Change: R1668L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1850 6.9e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135045
Predicted Effect probably damaging
Transcript: ENSMUST00000164334
AA Change: R1325L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131771
Gene: ENSMUSG00000000631
AA Change: R1325L

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1505 4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167856
AA Change: R1263L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128487
Gene: ENSMUSG00000000631
AA Change: R1263L

DomainStartEndE-ValueType
MYSc 16 789 1.3e-32 SMART
IQ 790 812 1.11e-3 SMART
Blast:MYSc 865 994 1e-14 BLAST
low complexity region 1003 1014 N/A INTRINSIC
low complexity region 1387 1406 N/A INTRINSIC
internal_repeat_1 1569 1627 2.13e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000168348
AA Change: R1704L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130696
Gene: ENSMUSG00000000631
AA Change: R1704L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 447 1230 4.16e-47 SMART
IQ 1231 1253 1.11e-3 SMART
Blast:MYSc 1306 1435 1e-14 BLAST
low complexity region 1444 1455 N/A INTRINSIC
low complexity region 1828 1847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169105
AA Change: R1668L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132149
Gene: ENSMUSG00000000631
AA Change: R1668L

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1878 7.3e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172303
AA Change: R1343L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129098
Gene: ENSMUSG00000000631
AA Change: R1343L

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Meta Mutation Damage Score 0.3357 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can bind GOLPH3, linking the Golgi to the cytoskeleton and influencing Golgi membrane trafficking. The encoded protein is also part of a complex that assembles lamellar actomyosin bundles and may be required for cell migration. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Nlrc3 G T 16: 3,964,087 T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Myo18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Myo18a APN 11 77847938 missense probably damaging 1.00
IGL00753:Myo18a APN 11 77825151 missense probably damaging 1.00
IGL01137:Myo18a APN 11 77827829 missense probably damaging 1.00
IGL01536:Myo18a APN 11 77820851 missense probably damaging 1.00
IGL01642:Myo18a APN 11 77864732 missense probably benign 0.07
IGL01728:Myo18a APN 11 77777856 missense probably damaging 0.99
IGL01780:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02286:Myo18a APN 11 77777985 nonsense probably null
IGL02350:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02357:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02420:Myo18a APN 11 77818693 missense possibly damaging 0.81
IGL02643:Myo18a APN 11 77778172 missense possibly damaging 0.67
IGL02667:Myo18a APN 11 77857852 splice site probably benign
IGL02869:Myo18a APN 11 77864786 missense probably damaging 1.00
IGL02869:Myo18a APN 11 77829873 splice site probably benign
IGL02962:Myo18a APN 11 77778235 missense probably damaging 1.00
IGL02963:Myo18a APN 11 77842018 splice site probably benign
IGL03410:Myo18a APN 11 77848004 missense probably damaging 0.99
IGL03050:Myo18a UTSW 11 77818770 missense probably benign 0.00
R0022:Myo18a UTSW 11 77843233 critical splice donor site probably null
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0098:Myo18a UTSW 11 77845765 missense probably damaging 1.00
R0322:Myo18a UTSW 11 77829800 missense probably damaging 1.00
R0373:Myo18a UTSW 11 77821042 missense probably benign 0.01
R0379:Myo18a UTSW 11 77850806 missense possibly damaging 0.84
R0513:Myo18a UTSW 11 77811594 intron probably benign
R0688:Myo18a UTSW 11 77824140 missense probably damaging 1.00
R0734:Myo18a UTSW 11 77847404 missense probably damaging 1.00
R0790:Myo18a UTSW 11 77840709 missense possibly damaging 0.95
R1099:Myo18a UTSW 11 77818901 splice site probably null
R1103:Myo18a UTSW 11 77823330 missense probably damaging 1.00
R1183:Myo18a UTSW 11 77857745 missense probably damaging 1.00
R1216:Myo18a UTSW 11 77818647 missense probably benign 0.35
R1331:Myo18a UTSW 11 77841579 missense probably benign 0.28
R1479:Myo18a UTSW 11 77842194 missense probably benign 0.04
R1723:Myo18a UTSW 11 77853314 missense probably damaging 0.97
R1742:Myo18a UTSW 11 77841467 missense probably damaging 0.99
R1796:Myo18a UTSW 11 77829344 missense possibly damaging 0.94
R1823:Myo18a UTSW 11 77825097 splice site probably benign
R1827:Myo18a UTSW 11 77818771 missense probably benign 0.00
R2033:Myo18a UTSW 11 77843099 splice site probably null
R2043:Myo18a UTSW 11 77823363 missense probably damaging 0.99
R2105:Myo18a UTSW 11 77850234 missense probably benign
R2191:Myo18a UTSW 11 77818615 missense probably damaging 0.99
R2264:Myo18a UTSW 11 77819972 splice site probably benign
R2370:Myo18a UTSW 11 77777770 missense probably benign 0.03
R3015:Myo18a UTSW 11 77859020 intron probably benign
R3433:Myo18a UTSW 11 77818044 splice site probably null
R3739:Myo18a UTSW 11 77845615 missense probably damaging 1.00
R3825:Myo18a UTSW 11 77777466 missense possibly damaging 0.47
R4056:Myo18a UTSW 11 77812013 missense possibly damaging 0.72
R4163:Myo18a UTSW 11 77829708 missense possibly damaging 0.72
R4184:Myo18a UTSW 11 77857787 missense probably damaging 1.00
R4620:Myo18a UTSW 11 77817947 missense possibly damaging 0.93
R4628:Myo18a UTSW 11 77824136 missense probably damaging 1.00
R4647:Myo18a UTSW 11 77817950 missense probably damaging 1.00
R4701:Myo18a UTSW 11 77817665 missense probably damaging 1.00
R4729:Myo18a UTSW 11 77777685 splice site probably null
R4731:Myo18a UTSW 11 77829759 missense probably benign 0.00
R4739:Myo18a UTSW 11 77823323 missense probably damaging 1.00
R4814:Myo18a UTSW 11 77859236 intron probably benign
R4889:Myo18a UTSW 11 77832412 missense probably damaging 1.00
R4988:Myo18a UTSW 11 77845521 critical splice donor site probably null
R5172:Myo18a UTSW 11 77824098 missense probably damaging 1.00
R5177:Myo18a UTSW 11 77864842 utr 3 prime probably benign
R5394:Myo18a UTSW 11 77853350 missense probably benign 0.14
R5643:Myo18a UTSW 11 77854687 missense probably benign 0.12
R5808:Myo18a UTSW 11 77829301 missense probably benign 0.34
R5871:Myo18a UTSW 11 77832480 missense probably damaging 1.00
R5936:Myo18a UTSW 11 77818213 missense probably damaging 1.00
R6017:Myo18a UTSW 11 77841523 missense probably damaging 0.96
R6053:Myo18a UTSW 11 77818176 missense probably damaging 1.00
R6271:Myo18a UTSW 11 77820809 missense probably damaging 1.00
R6486:Myo18a UTSW 11 77864822 missense possibly damaging 0.83
R6558:Myo18a UTSW 11 77850852 missense probably damaging 0.99
R6884:Myo18a UTSW 11 77819049 missense possibly damaging 0.67
R6983:Myo18a UTSW 11 77845515 missense probably benign 0.06
R6993:Myo18a UTSW 11 77859074 intron probably benign
R7071:Myo18a UTSW 11 77823827 missense probably damaging 1.00
R7074:Myo18a UTSW 11 77842561 missense probably benign 0.03
R7238:Myo18a UTSW 11 77842233 missense probably damaging 0.96
R7328:Myo18a UTSW 11 77807911 missense
R7527:Myo18a UTSW 11 77843580 missense probably benign 0.00
R7598:Myo18a UTSW 11 77847346 missense probably damaging 1.00
R7671:Myo18a UTSW 11 77859420 missense
R7958:Myo18a UTSW 11 77841557 missense probably damaging 1.00
R8098:Myo18a UTSW 11 77845401 missense probably damaging 0.97
R8168:Myo18a UTSW 11 77821142 missense probably damaging 0.99
R8318:Myo18a UTSW 11 77823389 missense probably benign 0.02
R8685:Myo18a UTSW 11 77854694 missense probably benign 0.00
R8778:Myo18a UTSW 11 77823324 missense probably damaging 1.00
R9023:Myo18a UTSW 11 77827651 missense probably damaging 1.00
R9059:Myo18a UTSW 11 77778073 missense possibly damaging 0.78
R9186:Myo18a UTSW 11 77859021 missense
R9321:Myo18a UTSW 11 77842544 missense probably damaging 0.97
R9357:Myo18a UTSW 11 77842188 missense probably damaging 1.00
R9407:Myo18a UTSW 11 77818770 missense probably benign 0.00
R9430:Myo18a UTSW 11 77818584 missense possibly damaging 0.64
R9576:Myo18a UTSW 11 77819001 missense probably damaging 1.00
R9585:Myo18a UTSW 11 77818669 missense probably benign 0.06
R9698:Myo18a UTSW 11 77829855 missense probably damaging 0.99
R9743:Myo18a UTSW 11 77832478 missense probably benign 0.10
R9777:Myo18a UTSW 11 77842254 missense possibly damaging 0.94
Y5407:Myo18a UTSW 11 77777815 missense probably benign 0.44
Z1177:Myo18a UTSW 11 77841995 missense probably damaging 1.00
Z1187:Myo18a UTSW 11 77853817 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCTTTCTCGCTGGGCAGTACAATC -3'
(R):5'- GCCATGCTGTAGGGCATATACAGAC -3'

Sequencing Primer
(F):5'- GGGCAGTACAATCCTGTTATACC -3'
(R):5'- AGTGGCTTGTCCAGACATC -3'
Posted On 2013-05-09