Incidental Mutation 'R4587:Cluap1'
ID344191
Institutional Source Beutler Lab
Gene Symbol Cluap1
Ensembl Gene ENSMUSG00000014232
Gene Nameclusterin associated protein 1
Synonyms
MMRRC Submission 042006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4587 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3908801-3941147 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 3933816 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040881] [ENSMUST00000040881] [ENSMUST00000139294]
Predicted Effect probably null
Transcript: ENSMUST00000040881
SMART Domains Protein: ENSMUSP00000043397
Gene: ENSMUSG00000014232

DomainStartEndE-ValueType
Pfam:Cluap1 14 283 2.5e-121 PFAM
low complexity region 297 307 N/A INTRINSIC
low complexity region 310 330 N/A INTRINSIC
low complexity region 360 388 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000040881
SMART Domains Protein: ENSMUSP00000043397
Gene: ENSMUSG00000014232

DomainStartEndE-ValueType
Pfam:Cluap1 14 283 2.5e-121 PFAM
low complexity region 297 307 N/A INTRINSIC
low complexity region 310 330 N/A INTRINSIC
low complexity region 360 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126677
Predicted Effect probably benign
Transcript: ENSMUST00000139294
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a single coiled-coil region. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous mutant mice exhibit mid-gestation lethality, failure of embryonic turning, enlarged pericardial sacs, neural tube defects and lack primary cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,152 I971T possibly damaging Het
Abhd16a T C 17: 35,101,087 probably null Het
Adsl T C 15: 80,967,767 probably null Het
Arhgap32 T C 9: 32,260,945 S1674P probably benign Het
Cd244 T G 1: 171,577,879 D277E probably benign Het
Ces1a A G 8: 93,025,304 Y401H probably damaging Het
Chd9 G T 8: 91,036,506 V2320F possibly damaging Het
Chrd A G 16: 20,738,575 E670G possibly damaging Het
Ckap2 A G 8: 22,176,976 S290P probably benign Het
Col15a1 C T 4: 47,257,184 T325M probably damaging Het
Dnah5 T C 15: 28,304,599 F1652S probably damaging Het
Dok6 T C 18: 89,301,196 Q312R probably benign Het
Glis1 C A 4: 107,627,543 H600N possibly damaging Het
Gm5155 C T 7: 17,886,224 L18F possibly damaging Het
Hivep1 A G 13: 42,156,228 D648G probably benign Het
Kif22 A T 7: 127,032,880 probably null Het
Lmtk3 A G 7: 45,794,080 D729G possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Nf1 T A 11: 79,536,037 probably null Het
Nom1 T C 5: 29,451,165 S843P possibly damaging Het
Olfr393 A G 11: 73,847,219 I302T probably benign Het
Pex14 A G 4: 148,963,564 probably benign Het
Ptcd1 T C 5: 145,154,721 T523A possibly damaging Het
Rasip1 T C 7: 45,632,735 V554A possibly damaging Het
Ric3 A T 7: 109,054,363 probably null Het
Skint4 G A 4: 112,087,024 C11Y probably damaging Het
Smr2 G A 5: 88,108,772 R103H probably benign Het
Sobp T C 10: 43,158,024 Y102C probably damaging Het
Taar7f T A 10: 24,050,575 F356I probably damaging Het
Tbcd T C 11: 121,605,271 V1044A possibly damaging Het
Tecpr1 C G 5: 144,212,590 V340L probably damaging Het
Tle3 A G 9: 61,374,013 I22V probably damaging Het
Trim30a G A 7: 104,435,644 R120* probably null Het
Trim72 A G 7: 128,007,992 D231G probably benign Het
Vmn2r59 T A 7: 42,046,224 N255Y probably benign Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Wnt7a A T 6: 91,366,342 probably null Het
Zfp51 C T 17: 21,464,916 Q598* probably null Het
Zfp617 A T 8: 71,929,159 N51I probably damaging Het
Zfp977 A T 7: 42,580,190 C304S probably damaging Het
Zic1 A G 9: 91,364,822 S66P probably damaging Het
Other mutations in Cluap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0304:Cluap1 UTSW 16 3929918 unclassified probably benign
R0545:Cluap1 UTSW 16 3933772 missense probably damaging 0.96
R1459:Cluap1 UTSW 16 3937589 missense probably damaging 1.00
R1511:Cluap1 UTSW 16 3919558 missense probably benign
R2136:Cluap1 UTSW 16 3933772 missense probably damaging 0.96
R3027:Cluap1 UTSW 16 3911532 nonsense probably null
R3926:Cluap1 UTSW 16 3911534 missense probably damaging 0.99
R4386:Cluap1 UTSW 16 3933722 missense possibly damaging 0.70
R5587:Cluap1 UTSW 16 3915484 missense probably damaging 1.00
R6010:Cluap1 UTSW 16 3937573 missense possibly damaging 0.91
R6169:Cluap1 UTSW 16 3928561 missense possibly damaging 0.50
R6181:Cluap1 UTSW 16 3933744 missense probably benign
R6194:Cluap1 UTSW 16 3929906 missense probably benign
R6492:Cluap1 UTSW 16 3928612 missense probably benign 0.03
R7091:Cluap1 UTSW 16 3940806 missense probably benign 0.01
R7131:Cluap1 UTSW 16 3940775 missense probably benign 0.00
R7248:Cluap1 UTSW 16 3919500 missense possibly damaging 0.76
R7421:Cluap1 UTSW 16 3940793 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGTGAATAAATCCAGGGAGTC -3'
(R):5'- GCAATGCAGTTTGAGAGACAGATC -3'

Sequencing Primer
(F):5'- CAGATGATTTTGCACTGGAGCCATAG -3'
(R):5'- TGCAGTTTGAGAGACAGATCCTGAAG -3'
Posted On2015-09-24