Incidental Mutation 'R4587:Zfp51'
ID344193
Institutional Source Beutler Lab
Gene Symbol Zfp51
Ensembl Gene ENSMUSG00000023892
Gene Namezinc finger protein 51
SynonymsZfp-51, zfec12
MMRRC Submission 042006-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R4587 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21450374-21465587 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 21464916 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 598 (Q598*)
Ref Sequence ENSEMBL: ENSMUSP00000045684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039577]
Predicted Effect probably null
Transcript: ENSMUST00000039577
AA Change: Q598*
SMART Domains Protein: ENSMUSP00000045684
Gene: ENSMUSG00000023892
AA Change: Q598*

DomainStartEndE-ValueType
KRAB 43 103 1.71e-22 SMART
ZnF_C2H2 214 236 2.36e-2 SMART
ZnF_C2H2 242 264 8.94e-3 SMART
ZnF_C2H2 270 292 7.9e-4 SMART
ZnF_C2H2 298 320 3.44e-4 SMART
ZnF_C2H2 326 348 7.15e-2 SMART
ZnF_C2H2 354 376 4.54e-4 SMART
ZnF_C2H2 382 404 3.44e-4 SMART
ZnF_C2H2 410 432 9.88e-5 SMART
ZnF_C2H2 438 460 3.16e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
ZnF_C2H2 494 517 2.57e-3 SMART
ZnF_C2H2 523 545 3.63e-3 SMART
ZnF_C2H2 551 573 1.4e-4 SMART
ZnF_C2H2 579 601 4.17e-3 SMART
ZnF_C2H2 607 629 2.79e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 9.08e-4 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
ZnF_C2H2 719 741 1.36e-2 SMART
ZnF_C2H2 747 769 6.82e1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,152 I971T possibly damaging Het
Abhd16a T C 17: 35,101,087 probably null Het
Adsl T C 15: 80,967,767 probably null Het
Arhgap32 T C 9: 32,260,945 S1674P probably benign Het
Cd244 T G 1: 171,577,879 D277E probably benign Het
Ces1a A G 8: 93,025,304 Y401H probably damaging Het
Chd9 G T 8: 91,036,506 V2320F possibly damaging Het
Chrd A G 16: 20,738,575 E670G possibly damaging Het
Ckap2 A G 8: 22,176,976 S290P probably benign Het
Cluap1 T A 16: 3,933,816 probably null Het
Col15a1 C T 4: 47,257,184 T325M probably damaging Het
Dnah5 T C 15: 28,304,599 F1652S probably damaging Het
Dok6 T C 18: 89,301,196 Q312R probably benign Het
Glis1 C A 4: 107,627,543 H600N possibly damaging Het
Gm5155 C T 7: 17,886,224 L18F possibly damaging Het
Hivep1 A G 13: 42,156,228 D648G probably benign Het
Kif22 A T 7: 127,032,880 probably null Het
Lmtk3 A G 7: 45,794,080 D729G possibly damaging Het
Mapk8ip3 G A 17: 24,904,787 P587L probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myt1l A G 12: 29,910,801 K1038E unknown Het
Nf1 T A 11: 79,536,037 probably null Het
Nom1 T C 5: 29,451,165 S843P possibly damaging Het
Olfr393 A G 11: 73,847,219 I302T probably benign Het
Pex14 A G 4: 148,963,564 probably benign Het
Ptcd1 T C 5: 145,154,721 T523A possibly damaging Het
Rasip1 T C 7: 45,632,735 V554A possibly damaging Het
Ric3 A T 7: 109,054,363 probably null Het
Skint4 G A 4: 112,087,024 C11Y probably damaging Het
Smr2 G A 5: 88,108,772 R103H probably benign Het
Sobp T C 10: 43,158,024 Y102C probably damaging Het
Taar7f T A 10: 24,050,575 F356I probably damaging Het
Tbcd T C 11: 121,605,271 V1044A possibly damaging Het
Tecpr1 C G 5: 144,212,590 V340L probably damaging Het
Tle3 A G 9: 61,374,013 I22V probably damaging Het
Trim30a G A 7: 104,435,644 R120* probably null Het
Trim72 A G 7: 128,007,992 D231G probably benign Het
Vmn2r59 T A 7: 42,046,224 N255Y probably benign Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Wnt7a A T 6: 91,366,342 probably null Het
Zfp617 A T 8: 71,929,159 N51I probably damaging Het
Zfp977 A T 7: 42,580,190 C304S probably damaging Het
Zic1 A G 9: 91,364,822 S66P probably damaging Het
Other mutations in Zfp51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp51 APN 17 21463452 missense probably benign 0.11
IGL00971:Zfp51 APN 17 21463582 missense probably benign 0.03
IGL02002:Zfp51 APN 17 21463959 missense probably damaging 0.98
IGL02268:Zfp51 APN 17 21463419 nonsense probably null
IGL03249:Zfp51 APN 17 21463439 missense probably damaging 1.00
R1569:Zfp51 UTSW 17 21456380 missense probably benign 0.01
R1853:Zfp51 UTSW 17 21464323 missense probably damaging 1.00
R1989:Zfp51 UTSW 17 21456320 missense possibly damaging 0.90
R2285:Zfp51 UTSW 17 21463875 missense probably damaging 1.00
R2407:Zfp51 UTSW 17 21463831 missense probably damaging 0.98
R2890:Zfp51 UTSW 17 21463856 missense probably damaging 1.00
R3918:Zfp51 UTSW 17 21463440 missense probably benign
R4529:Zfp51 UTSW 17 21464736 missense probably damaging 1.00
R4866:Zfp51 UTSW 17 21461750 missense possibly damaging 0.61
R4872:Zfp51 UTSW 17 21464671 missense probably benign 0.26
R4961:Zfp51 UTSW 17 21456353 missense probably benign 0.01
R5392:Zfp51 UTSW 17 21465322 missense possibly damaging 0.60
R5611:Zfp51 UTSW 17 21464092 missense probably damaging 1.00
R7109:Zfp51 UTSW 17 21463569 missense possibly damaging 0.80
R7129:Zfp51 UTSW 17 21461709 missense probably damaging 1.00
R7269:Zfp51 UTSW 17 21463698 missense probably benign 0.09
R7303:Zfp51 UTSW 17 21463796 missense probably benign 0.24
R7514:Zfp51 UTSW 17 21463500 missense probably benign 0.37
R7665:Zfp51 UTSW 17 21463581 missense probably benign 0.00
R8073:Zfp51 UTSW 17 21464032 missense probably damaging 1.00
R8177:Zfp51 UTSW 17 21463867 missense probably benign 0.05
X0062:Zfp51 UTSW 17 21464995 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATCCTTTACCCAGCGTGCATAT -3'
(R):5'- AAAGGACTTGTCACATTCCATACA -3'

Sequencing Primer
(F):5'- ACCCAGCGTGCATATCTTAG -3'
(R):5'- CACAGTCTCTGCATTTGTAAGG -3'
Posted On2015-09-24