Mutagenetix > Incidental Mutation

Incidental Mutation 'R0064:Abca9'

34420

Institutional Source

Beutler Lab

Gene Symbol

Abca9

Ensembl Gene

ENSMUSG00000041797

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 9

Synonyms

D630040K07Rik

MMRRC Submission

038356-MU

Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110100749-110168196 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 110144871 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 641 (L641R)

Ref Sequence

ENSEMBL: ENSMUSP00000036338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044850]

AlphaFold

Q8K449

Predicted Effect

probably damaging
Transcript: ENSMUST00000044850
AA Change: L641R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: L641R

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	419	2.7e-31	PFAM
AAA	509	693	9.28e-12	SMART
low complexity region	817	837	N/A	INTRINSIC
transmembrane domain	862	884	N/A	INTRINSIC
Pfam:ABC2_membrane_3	918	1219	5.2e-15	PFAM
low complexity region	1250	1259	N/A	INTRINSIC
AAA	1317	1497	8.47e-6	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Arhgef17	C	A	7: 100,881,354	M1408I	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cdon	A	G	9: 35,489,227	H1079R	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nlrc3	G	T	16: 3,964,087	T486K	possibly damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Plce1	T	C	19: 38,780,784		probably null	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Thbs1	A	T	2: 118,123,914		probably null	Het
Tie1	A	G	4: 118,489,701	V2A	possibly damaging	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Vmn2r111	T	A	17: 22,572,072	I82L	probably benign	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Abca9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Abca9	APN	11	110160516	missense	probably benign
IGL00467:Abca9	APN	11	110145670	splice site	probably benign
IGL00886:Abca9	APN	11	110163275	missense	possibly damaging	0.93
IGL01340:Abca9	APN	11	110130627	missense	probably benign
IGL01351:Abca9	APN	11	110148903	missense	probably damaging	0.99
IGL01383:Abca9	APN	11	110113293	splice site	probably benign
IGL01384:Abca9	APN	11	110145637	missense	probably damaging	1.00
IGL01482:Abca9	APN	11	110120773	missense	probably benign	0.05
IGL01586:Abca9	APN	11	110154417	missense	probably damaging	0.99
IGL01589:Abca9	APN	11	110155177	missense	probably damaging	1.00
IGL01926:Abca9	APN	11	110135329	splice site	probably benign
IGL02059:Abca9	APN	11	110160394	splice site	probably benign
IGL02084:Abca9	APN	11	110130597	missense	probably benign
IGL02096:Abca9	APN	11	110102533	missense	probably damaging	1.00
IGL02096:Abca9	APN	11	110165980	missense	probably benign	0.01
IGL02290:Abca9	APN	11	110135351	missense	probably damaging	1.00
IGL02303:Abca9	APN	11	110154550	missense	probably damaging	1.00
IGL02549:Abca9	APN	11	110102053	missense	probably damaging	1.00
IGL02687:Abca9	APN	11	110114232	missense	probably damaging	1.00
IGL02752:Abca9	APN	11	110127368	missense	probably damaging	1.00
IGL02814:Abca9	APN	11	110154467	missense	possibly damaging	0.90
IGL02878:Abca9	APN	11	110138329	missense	probably benign	0.01
IGL03088:Abca9	APN	11	110144261	missense	probably benign	0.06
IGL03231:Abca9	APN	11	110155268	missense	probably damaging	0.96
R0050:Abca9	UTSW	11	110145591	missense	probably damaging	1.00
R0050:Abca9	UTSW	11	110145591	missense	probably damaging	1.00
R0064:Abca9	UTSW	11	110144872	missense	probably damaging	1.00
R0068:Abca9	UTSW	11	110145579	missense	probably damaging	0.99
R0189:Abca9	UTSW	11	110108653	missense	probably damaging	1.00
R0189:Abca9	UTSW	11	110141662	splice site	probably benign
R0375:Abca9	UTSW	11	110115447	missense	probably benign	0.00
R0601:Abca9	UTSW	11	110117058	critical splice donor site	probably null
R0624:Abca9	UTSW	11	110139620	missense	probably damaging	1.00
R0652:Abca9	UTSW	11	110152063	missense	probably benign	0.02
R1004:Abca9	UTSW	11	110151954	missense	possibly damaging	0.88
R1222:Abca9	UTSW	11	110145064	splice site	probably benign
R1451:Abca9	UTSW	11	110127447	missense	probably damaging	1.00
R1462:Abca9	UTSW	11	110160516	missense	probably benign
R1462:Abca9	UTSW	11	110160516	missense	probably benign
R1474:Abca9	UTSW	11	110145579	missense	probably damaging	0.99
R1499:Abca9	UTSW	11	110139632	missense	probably benign	0.00
R1778:Abca9	UTSW	11	110130716	nonsense	probably null
R2015:Abca9	UTSW	11	110131846	missense	probably benign	0.01
R2295:Abca9	UTSW	11	110148903	missense	probably damaging	0.99
R2303:Abca9	UTSW	11	110158226	missense	probably benign	0.01
R2403:Abca9	UTSW	11	110115454	missense	probably benign	0.16
R2886:Abca9	UTSW	11	110144886	splice site	probably benign
R3435:Abca9	UTSW	11	110154430	missense	probably benign	0.24
R3976:Abca9	UTSW	11	110148789	missense	probably benign	0.25
R4335:Abca9	UTSW	11	110152017	missense	probably damaging	1.00
R4411:Abca9	UTSW	11	110151955	missense	probably benign	0.00
R4613:Abca9	UTSW	11	110144784	missense	probably benign	0.26
R4690:Abca9	UTSW	11	110148880	missense	probably damaging	1.00
R4720:Abca9	UTSW	11	110127422	missense	probably damaging	1.00
R4751:Abca9	UTSW	11	110130570	missense	probably benign	0.00
R4797:Abca9	UTSW	11	110118119	missense	probably benign
R4818:Abca9	UTSW	11	110155154	critical splice donor site	probably null
R4903:Abca9	UTSW	11	110147001	missense	probably damaging	1.00
R4971:Abca9	UTSW	11	110152048	missense	probably benign	0.43
R4977:Abca9	UTSW	11	110136073	missense	probably benign	0.00
R5019:Abca9	UTSW	11	110165934	missense	probably benign
R5079:Abca9	UTSW	11	110145569	missense	possibly damaging	0.47
R5082:Abca9	UTSW	11	110131868	missense	probably benign
R5093:Abca9	UTSW	11	110141532	missense	probably damaging	0.98
R5212:Abca9	UTSW	11	110107226	missense	probably benign	0.02
R5350:Abca9	UTSW	11	110115538	missense	probably benign
R5368:Abca9	UTSW	11	110145546	missense	probably damaging	1.00
R5432:Abca9	UTSW	11	110141554	missense	possibly damaging	0.83
R5436:Abca9	UTSW	11	110134236	missense	probably damaging	1.00
R5497:Abca9	UTSW	11	110130692	missense	probably damaging	1.00
R5503:Abca9	UTSW	11	110141610	missense	probably damaging	1.00
R5594:Abca9	UTSW	11	110144862	missense	probably damaging	1.00
R5742:Abca9	UTSW	11	110160417	missense	probably damaging	0.98
R5776:Abca9	UTSW	11	110107460	splice site	probably null
R5781:Abca9	UTSW	11	110101987	missense	probably damaging	1.00
R5872:Abca9	UTSW	11	110117076	missense	possibly damaging	0.70
R5923:Abca9	UTSW	11	110160552	missense	probably benign	0.09
R6020:Abca9	UTSW	11	110145613	missense	possibly damaging	0.86
R6179:Abca9	UTSW	11	110134254	missense	probably benign	0.05
R6245:Abca9	UTSW	11	110135423	missense	probably damaging	1.00
R6249:Abca9	UTSW	11	110145627	missense	probably benign
R6365:Abca9	UTSW	11	110145655	missense	possibly damaging	0.63
R6385:Abca9	UTSW	11	110134254	missense	probably damaging	0.99
R6481:Abca9	UTSW	11	110165962	nonsense	probably null
R6675:Abca9	UTSW	11	110115476	missense	probably benign
R6909:Abca9	UTSW	11	110115497	missense	probably benign	0.01
R7390:Abca9	UTSW	11	110145661	missense	probably benign	0.01
R7429:Abca9	UTSW	11	110127426	frame shift	probably null
R7431:Abca9	UTSW	11	110127426	frame shift	probably null
R7621:Abca9	UTSW	11	110160533	missense	probably benign	0.00
R7623:Abca9	UTSW	11	110107558	missense	probably benign	0.27
R7660:Abca9	UTSW	11	110115452	missense	probably benign
R7784:Abca9	UTSW	11	110154417	nonsense	probably null
R7798:Abca9	UTSW	11	110138179	missense	probably benign	0.45
R7839:Abca9	UTSW	11	110134259	missense	probably benign	0.43
R7891:Abca9	UTSW	11	110163272	missense	probably benign	0.03
R7894:Abca9	UTSW	11	110106589	missense	possibly damaging	0.49
R8030:Abca9	UTSW	11	110120708	missense	probably benign
R8133:Abca9	UTSW	11	110127463	missense	possibly damaging	0.88
R8195:Abca9	UTSW	11	110138329	missense	probably benign	0.01
R8304:Abca9	UTSW	11	110107128	critical splice donor site	probably null
R8386:Abca9	UTSW	11	110130692	missense	probably damaging	1.00
R8390:Abca9	UTSW	11	110145630	missense	probably benign	0.01
R8692:Abca9	UTSW	11	110141583	missense	probably benign	0.11
R8721:Abca9	UTSW	11	110144289	missense	possibly damaging	0.82
R8738:Abca9	UTSW	11	110165991	start codon destroyed	probably null	1.00
R8900:Abca9	UTSW	11	110154392	missense	probably benign
R8948:Abca9	UTSW	11	110163380	critical splice acceptor site	probably null
R8950:Abca9	UTSW	11	110163380	critical splice acceptor site	probably null
R8964:Abca9	UTSW	11	110147249	nonsense	probably null
R9019:Abca9	UTSW	11	110120696	missense
R9034:Abca9	UTSW	11	110148789	missense	probably benign	0.25
R9035:Abca9	UTSW	11	110130635	missense	probably damaging	0.97
R9086:Abca9	UTSW	11	110102053	missense	probably damaging	1.00
R9199:Abca9	UTSW	11	110165944	missense	possibly damaging	0.49
R9402:Abca9	UTSW	11	110158328	missense	probably benign	0.14
R9414:Abca9	UTSW	11	110144274	missense	probably damaging	0.97
R9554:Abca9	UTSW	11	110138281	missense	probably benign
R9626:Abca9	UTSW	11	110120780	missense	probably benign	0.01
R9651:Abca9	UTSW	11	110115493	missense	probably benign	0.09
R9665:Abca9	UTSW	11	110115454	missense	probably benign
R9665:Abca9	UTSW	11	110115455	missense	probably benign	0.00
R9731:Abca9	UTSW	11	110134198	missense	probably benign
Z1176:Abca9	UTSW	11	110135375	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCATAGGACAAAGCATTGGGGACAC -3'
(R):5'- CTTGGGATCGCCATTTTAGGAGACC -3'

Sequencing Primer
(F):5'- GTCTAAGGGGCCTACTTGTAACC -3'
(R):5'- CATTTTAGGAGACCCCCAGGTAAG -3'

Protein Function and Prediction

Abca9 encodes ABCA9, a member of the A subfamily of ATP-binding cassette (ABC) transporters that function to translocate molecules across cellular membranes. ABCA9 has up to 7 transmembane segments in two transmembrane domains as well as two nucleotide-binding domains. The nucleotide-binding domains contain three motifs: Walker A and B motifs (1). ABCA9 is ubiquitously expressed in humans, with highest levels in the adult hear, brain, and liver (1). ABCA9 is suppressed by cholesterol import and induced during monocyte differentiation (1). ABCA9 is proposed to function in monocyte differentiation and macrophage lipid homeostasis (1).

References

1. Piehler, A., Kaminski, W. E., Wenzel, J. J., Langmann, T., and Schmitz, G. (2002) Molecular Structure of a Novel Cholesterol-Responsive A Subclass ABC Transporter, ABCA9. Biochem Biophys Res Commun. 295, 408-416.

Posted On

2013-05-09

Science Writer

Anne Murray