Incidental Mutation 'R4594:Mael'
ID 344241
Institutional Source Beutler Lab
Gene Symbol Mael
Ensembl Gene ENSMUSG00000040629
Gene Name maelstrom spermatogenic transposon silencer
Synonyms 4933405K18Rik
MMRRC Submission 041810-MU
Accession Numbers

Genbank: NM_175296; MGI: 2138453

Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock # R4594 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 166201201-166238747 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 166235487 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 132 (Q132L)
Ref Sequence ENSEMBL: ENSMUSP00000045828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038782] [ENSMUST00000194057]
AlphaFold Q8BVN9
Predicted Effect probably damaging
Transcript: ENSMUST00000038782
AA Change: Q132L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045828
Gene: ENSMUSG00000040629
AA Change: Q132L

DomainStartEndE-ValueType
Pfam:HMG_box_2 2 73 4.4e-27 PFAM
Pfam:Maelstrom 128 329 1.6e-58 PFAM
low complexity region 399 407 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194057
AA Change: Q132L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141652
Gene: ENSMUSG00000040629
AA Change: Q132L

DomainStartEndE-ValueType
Pfam:HMG_box_2 2 73 1.6e-24 PFAM
Pfam:Maelstrom 128 314 2.6e-43 PFAM
low complexity region 385 393 N/A INTRINSIC
Meta Mutation Damage Score 0.2278 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele are infertile and display small testes, a complete block of spermatogenesis due to apoptosis during meiotic prophase I, defects in homologous chromosome synapsis, DNA damage, reduced DNA methylation, and derepression of L1 retrotransposons in the adult testis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Mael
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Mael APN 1 166204849 missense probably damaging 1.00
IGL01153:Mael APN 1 166202350 missense possibly damaging 0.89
D4043:Mael UTSW 1 166236886 missense probably benign 0.00
R0218:Mael UTSW 1 166238590 missense probably damaging 1.00
R0811:Mael UTSW 1 166235399 critical splice donor site probably null
R0812:Mael UTSW 1 166235399 critical splice donor site probably null
R1544:Mael UTSW 1 166202290 missense probably benign 0.28
R2096:Mael UTSW 1 166225675 missense probably benign 0.41
R2914:Mael UTSW 1 166226610 missense probably damaging 1.00
R3031:Mael UTSW 1 166204806 missense probably damaging 1.00
R3709:Mael UTSW 1 166238566 missense probably damaging 0.99
R3710:Mael UTSW 1 166238566 missense probably damaging 0.99
R3880:Mael UTSW 1 166236868 splice site probably benign
R4669:Mael UTSW 1 166235508 missense probably damaging 1.00
R7382:Mael UTSW 1 166201598 missense probably benign 0.00
R8024:Mael UTSW 1 166226627 missense probably damaging 0.99
R8519:Mael UTSW 1 166235558 critical splice acceptor site probably null
R8793:Mael UTSW 1 166201688 missense probably benign 0.41
R9090:Mael UTSW 1 166204855 missense probably benign 0.01
R9147:Mael UTSW 1 166201690 missense probably benign 0.08
R9148:Mael UTSW 1 166201690 missense probably benign 0.08
R9271:Mael UTSW 1 166204855 missense probably benign 0.01
R9382:Mael UTSW 1 166225713 missense probably damaging 0.97
X0018:Mael UTSW 1 166201568 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGACTTAAGTCTTATGTCTATGCAC -3'
(R):5'- CTTGACAAATGTGGTTGCAAAG -3'

Sequencing Primer
(F):5'- GTCTATGCACTCTTTAAGAACCCAC -3'
(R):5'- GATTCACTAGCAAAGACAGA -3'
Posted On 2015-09-25