Incidental Mutation 'R4594:Kynu'
ID344244
Institutional Source Beutler Lab
Gene Symbol Kynu
Ensembl Gene ENSMUSG00000026866
Gene Namekynureninase (L-kynurenine hydrolase)
Synonyms
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4594 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location43555329-43682715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43679890 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 395 (S395T)
Ref Sequence ENSEMBL: ENSMUSP00000108445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028223] [ENSMUST00000112826]
Predicted Effect probably benign
Transcript: ENSMUST00000028223
AA Change: S395T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000028223
Gene: ENSMUSG00000026866
AA Change: S395T

DomainStartEndE-ValueType
Pfam:Aminotran_5 70 400 3.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112826
AA Change: S395T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000108445
Gene: ENSMUSG00000026866
AA Change: S395T

DomainStartEndE-ValueType
Pfam:Aminotran_5 70 405 8.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148855
Meta Mutation Damage Score 0.0986 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Kynu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Kynu APN 2 43671382 missense possibly damaging 0.91
IGL01974:Kynu APN 2 43681340 unclassified probably benign
R0099:Kynu UTSW 2 43629053 critical splice donor site probably null
R0304:Kynu UTSW 2 43679881 missense probably damaging 0.99
R1681:Kynu UTSW 2 43679825 missense probably damaging 1.00
R1799:Kynu UTSW 2 43604157 missense possibly damaging 0.65
R2016:Kynu UTSW 2 43604277 nonsense probably null
R2345:Kynu UTSW 2 43581385 missense probably damaging 1.00
R3085:Kynu UTSW 2 43602300 missense probably benign 0.00
R3825:Kynu UTSW 2 43681439 missense probably benign
R4091:Kynu UTSW 2 43679872 missense possibly damaging 0.94
R4241:Kynu UTSW 2 43681410 missense probably benign 0.00
R4673:Kynu UTSW 2 43679803 missense probably damaging 1.00
R4871:Kynu UTSW 2 43679818 missense possibly damaging 0.58
R5371:Kynu UTSW 2 43589394 missense probably benign 0.00
R6272:Kynu UTSW 2 43634989 missense probably benign 0.01
R6342:Kynu UTSW 2 43681451 missense probably benign 0.09
R6866:Kynu UTSW 2 43563110 nonsense probably null
R7203:Kynu UTSW 2 43681353 missense probably damaging 1.00
R8163:Kynu UTSW 2 43628954 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTCTCTGTAAATCAGTAGCCAC -3'
(R):5'- CGCTGAGTGCTAAGTTGATGTC -3'

Sequencing Primer
(F):5'- GCCACTGCTAATCTGATTGTGAC -3'
(R):5'- GATTGGTTGACTAGAAGGATATGC -3'
Posted On2015-09-25