Mutagenetix > Incidental Mutations

Incidental Mutation 'R4594:Alpk1'

344247

Institutional Source

Beutler Lab

Gene Symbol

Alpk1

Ensembl Gene

ENSMUSG00000028028

Gene Name

alpha-kinase 1

Synonyms

8430410J10Rik

MMRRC Submission

041810-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4594 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127670310-127780527 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 127683554 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 285 (A285V)

Ref Sequence

ENSEMBL: ENSMUSP00000143223 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000029662
AA Change: A285V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: A285V

Domain	Start	End	E-Value	Type
low complexity region	85	97	N/A	INTRINSIC
low complexity region	618	628	N/A	INTRINSIC
low complexity region	700	714	N/A	INTRINSIC
low complexity region	902	914	N/A	INTRINSIC
low complexity region	924	947	N/A	INTRINSIC
Alpha_kinase	1008	1215	1.03e-81	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000159720
AA Change: A105V

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160586

Predicted Effect

probably damaging
Transcript: ENSMUST00000198955
AA Change: A285V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: A285V

Domain	Start	End	E-Value	Type
low complexity region	85	97	N/A	INTRINSIC
low complexity region	618	628	N/A	INTRINSIC
low complexity region	700	714	N/A	INTRINSIC
low complexity region	902	914	N/A	INTRINSIC
low complexity region	924	947	N/A	INTRINSIC
Alpha_kinase	1008	1215	1.03e-81	SMART

Meta Mutation Damage Score

0.1462

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,575,754	T64A	probably damaging	Het
4933427I04Rik	A	T	4: 123,860,538	T82S	possibly damaging	Het
Adamts15	A	T	9: 30,921,447	I264N	probably damaging	Het
Auh	T	C	13: 52,912,966		probably benign	Het
BC030499	T	A	11: 78,291,647	V94D	possibly damaging	Het
Cacna2d3	A	G	14: 28,982,346	F826S	probably benign	Het
Ccdc54	G	T	16: 50,590,017	Y295*	probably null	Het
Ctnna3	G	A	10: 64,586,079	V551I	probably benign	Het
Diaph3	C	T	14: 86,986,037	C347Y	probably damaging	Het
Dnajb5	A	G	4: 42,950,842		probably benign	Het
Dscam	A	T	16: 96,717,996	I847K	possibly damaging	Het
Fam8a1	T	C	13: 46,671,266	F243S	probably damaging	Het
Fat2	T	C	11: 55,284,752	I1712V	possibly damaging	Het
Fgfr1	T	C	8: 25,573,836	V793A	probably damaging	Het
Got2	T	C	8: 95,872,186	E196G	probably benign	Het
Gsk3b	G	A	16: 38,170,701	C107Y	possibly damaging	Het
H2-M5	T	C	17: 36,987,805	T250A	possibly damaging	Het
Il17f	T	A	1: 20,777,802	T151S	probably damaging	Het
Ints12	A	G	3: 133,108,868	N279D	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kynu	T	A	2: 43,679,890	S395T	probably benign	Het
Llgl1	C	T	11: 60,706,321	T226I	probably benign	Het
Mael	T	A	1: 166,235,487	Q132L	probably damaging	Het
Mcpt1	A	T	14: 56,018,652	R49S	probably benign	Het
Meioc	G	T	11: 102,674,166	G203C	probably damaging	Het
Mfsd4b1	A	G	10: 40,007,317	S46P	probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mx2	C	A	16: 97,547,432	Y268*	probably null	Het
Myom1	A	G	17: 71,100,074	D1064G	possibly damaging	Het
Nek11	A	G	9: 105,392,847		probably null	Het
Nfe2	A	G	15: 103,248,805	L253S	probably damaging	Het
Nup205	T	C	6: 35,196,489	I478T	probably benign	Het
Nxpe2	T	C	9: 48,319,482	D529G	probably damaging	Het
Oard1	T	C	17: 48,415,239	S88P	possibly damaging	Het
Olfr1370	C	T	13: 21,072,522	V260I	probably benign	Het
Olfr231	G	T	1: 174,117,320	T232N	probably damaging	Het
Olfr639	T	C	7: 104,012,417	D95G	probably benign	Het
Olfr678	T	C	7: 105,069,590	V41A	probably benign	Het
Olfr732	G	A	14: 50,281,683	T190I	probably benign	Het
Olfr741	A	G	14: 50,486,162	R235G	probably benign	Het
Olfr906	A	C	9: 38,488,761	H244P	probably damaging	Het
Osgin1	C	T	8: 119,445,253	T262I	possibly damaging	Het
Plcb4	A	T	2: 136,002,599	M146L	probably damaging	Het
Prkdc	A	T	16: 15,767,966	E2456V	possibly damaging	Het
Ptk2	G	A	15: 73,206,196	A1004V	probably damaging	Het
Rab15	G	A	12: 76,800,671		probably benign	Het
Rad51ap2	T	C	12: 11,457,880	V601A	probably benign	Het
Rasef	T	A	4: 73,780,389	I12F	possibly damaging	Het
Rdh14	T	A	12: 10,394,567	N139K	probably damaging	Het
Rexo2	A	T	9: 48,480,417	V46E	probably damaging	Het
Slmap	A	T	14: 26,465,617	L68H	probably damaging	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Tmem132e	T	C	11: 82,435,068	I206T	possibly damaging	Het
Trappc8	A	T	18: 20,836,948	V995E	probably benign	Het
Vmn2r12	A	C	5: 109,086,435	I637S	probably damaging	Het
Vmn2r124	T	C	17: 18,073,969	F773L	probably damaging	Het
Vmn2r99	A	T	17: 19,393,662	D548V	probably damaging	Het
Wdr81	T	C	11: 75,445,794	N1590D	probably benign	Het
Zbtb6	A	T	2: 37,429,042	N291K	possibly damaging	Het
Zfp119a	G	A	17: 55,866,325	R173C	probably benign	Het
Zmynd15	T	C	11: 70,464,182	L335P	probably damaging	Het

Other mutations in Alpk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Alpk1	APN	3	127681043	missense	probably damaging	1.00
IGL00722:Alpk1	APN	3	127680213	missense	probably benign	0.00
IGL01066:Alpk1	APN	3	127680225	missense	probably benign	0.22
IGL01351:Alpk1	APN	3	127672362	missense	probably damaging	0.97
IGL01412:Alpk1	APN	3	127679972	missense	possibly damaging	0.60
IGL01469:Alpk1	APN	3	127677752	splice site	probably null
IGL01585:Alpk1	APN	3	127679813	missense	probably benign	0.01
IGL02308:Alpk1	APN	3	127729282	missense	probably damaging	0.99
IGL02325:Alpk1	APN	3	127679903	missense	probably benign	0.43
IGL02458:Alpk1	APN	3	127681319	critical splice donor site	probably null
IGL02553:Alpk1	APN	3	127673321	missense	probably damaging	1.00
IGL02717:Alpk1	APN	3	127681100	missense	possibly damaging	0.76
IGL02729:Alpk1	APN	3	127681072	missense	possibly damaging	0.87
IGL02832:Alpk1	APN	3	127679943	missense	possibly damaging	0.63
IGL02892:Alpk1	APN	3	127680122	missense	possibly damaging	0.92
IGL03178:Alpk1	APN	3	127680221	nonsense	probably null
R0427:Alpk1	UTSW	3	127671071	missense	probably damaging	1.00
R0981:Alpk1	UTSW	3	127679402	missense	possibly damaging	0.62
R1174:Alpk1	UTSW	3	127680810	missense	probably damaging	0.99
R1793:Alpk1	UTSW	3	127677798	missense	probably damaging	1.00
R1859:Alpk1	UTSW	3	127681100	missense	possibly damaging	0.76
R2173:Alpk1	UTSW	3	127683590	missense	probably damaging	1.00
R2235:Alpk1	UTSW	3	127680920	missense	probably benign	0.01
R2373:Alpk1	UTSW	3	127679808	missense	probably benign	0.00
R3803:Alpk1	UTSW	3	127679837	missense	possibly damaging	0.93
R3927:Alpk1	UTSW	3	127677716	missense	probably damaging	1.00
R4356:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4357:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4358:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4379:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4381:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4470:Alpk1	UTSW	3	127679526	missense	probably damaging	1.00
R4471:Alpk1	UTSW	3	127679526	missense	probably damaging	1.00
R4473:Alpk1	UTSW	3	127680018	missense	probably damaging	0.97
R4474:Alpk1	UTSW	3	127680018	missense	probably damaging	0.97
R4476:Alpk1	UTSW	3	127680018	missense	probably damaging	0.97
R4512:Alpk1	UTSW	3	127684471	intron	probably benign
R4678:Alpk1	UTSW	3	127679858	missense	probably damaging	0.99
R4707:Alpk1	UTSW	3	127687592	missense	possibly damaging	0.50
R4784:Alpk1	UTSW	3	127687592	missense	possibly damaging	0.50
R4785:Alpk1	UTSW	3	127687592	missense	possibly damaging	0.50
R4820:Alpk1	UTSW	3	127671059	missense	probably benign	0.06
R4887:Alpk1	UTSW	3	127673475	missense	probably damaging	1.00
R5088:Alpk1	UTSW	3	127685320	splice site	probably benign
R5169:Alpk1	UTSW	3	127671101	missense	probably damaging	1.00
R5280:Alpk1	UTSW	3	127681164	missense	probably benign	0.00
R5351:Alpk1	UTSW	3	127729292	missense	probably damaging	0.96
R5478:Alpk1	UTSW	3	127677719	missense	probably damaging	1.00
R5627:Alpk1	UTSW	3	127680647	missense	probably damaging	0.99
R5781:Alpk1	UTSW	3	127680035	missense	possibly damaging	0.92
R5842:Alpk1	UTSW	3	127680969	missense	probably damaging	1.00
R5847:Alpk1	UTSW	3	127680074	missense	probably benign	0.06
R5940:Alpk1	UTSW	3	127670946	missense	probably benign
R6187:Alpk1	UTSW	3	127673342	missense	probably damaging	1.00
R6306:Alpk1	UTSW	3	127686316	missense	probably damaging	1.00
R6414:Alpk1	UTSW	3	127680209	missense	probably benign
R6701:Alpk1	UTSW	3	127729336	missense	probably damaging	1.00
R6735:Alpk1	UTSW	3	127724449	missense	probably damaging	1.00
R6850:Alpk1	UTSW	3	127729363	missense	possibly damaging	0.87
R7173:Alpk1	UTSW	3	127684375	nonsense	probably null
R7258:Alpk1	UTSW	3	127724466	missense	probably damaging	1.00
R7412:Alpk1	UTSW	3	127672494	missense	probably damaging	1.00
R7412:Alpk1	UTSW	3	127695733	missense	probably damaging	1.00
R7498:Alpk1	UTSW	3	127679778	missense	probably benign	0.22
R7635:Alpk1	UTSW	3	127695661	missense	probably benign	0.01
R7660:Alpk1	UTSW	3	127680967	missense	probably damaging	1.00
R7682:Alpk1	UTSW	3	127672546	missense	possibly damaging	0.94
R7732:Alpk1	UTSW	3	127684392	missense
R7827:Alpk1	UTSW	3	127680051	missense	probably benign	0.00
R8029:Alpk1	UTSW	3	127729285	missense	possibly damaging	0.95
R8383:Alpk1	UTSW	3	127724436	missense	probably benign	0.41
R8478:Alpk1	UTSW	3	127729312	missense	probably damaging	1.00
R8765:Alpk1	UTSW	3	127672469	missense	probably damaging	1.00
R8816:Alpk1	UTSW	3	127684375	nonsense	probably null
R8907:Alpk1	UTSW	3	127680993	nonsense	probably null
R8972:Alpk1	UTSW	3	127679583	missense	probably damaging	1.00
R8974:Alpk1	UTSW	3	127679931	missense	probably benign	0.03
R9039:Alpk1	UTSW	3	127679543	missense	probably damaging	1.00
R9202:Alpk1	UTSW	3	127686289	missense
R9394:Alpk1	UTSW	3	127672538	missense	probably damaging	1.00
R9421:Alpk1	UTSW	3	127673420	missense	probably damaging	1.00
R9436:Alpk1	UTSW	3	127685275	missense
Z1176:Alpk1	UTSW	3	127673438	missense	probably damaging	1.00
Z1177:Alpk1	UTSW	3	127685307	missense

Predicted Primers

PCR Primer
(F):5'- GGCGTCAGGATATGGTCATTC -3'
(R):5'- AGGTTTTCTTGGCACTGTCC -3'

Sequencing Primer
(F):5'- GGTCATTCTAACTAATAGTACCCCC -3'
(R):5'- GCACTGTCCTGGTAGGTTCC -3'

Posted On

2015-09-25