Mutagenetix > Incidental Mutations

Incidental Mutation 'R4594:Nup205'

344255

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

MMRRC Submission

041810-MU

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R4594 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 35196489 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 478 (I478T)

Ref Sequence

ENSEMBL: ENSMUSP00000144126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

Predicted Effect

probably benign
Transcript: ENSMUST00000043815
AA Change: I425T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: I425T

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201374
AA Change: I478T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: I478T

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202898

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,575,754	T64A	probably damaging	Het
4933427I04Rik	A	T	4: 123,860,538	T82S	possibly damaging	Het
Adamts15	A	T	9: 30,921,447	I264N	probably damaging	Het
Alpk1	G	A	3: 127,683,554	A285V	probably damaging	Het
Auh	T	C	13: 52,912,966		probably benign	Het
BC030499	T	A	11: 78,291,647	V94D	possibly damaging	Het
Cacna2d3	A	G	14: 28,982,346	F826S	probably benign	Het
Ccdc54	G	T	16: 50,590,017	Y295*	probably null	Het
Ctnna3	G	A	10: 64,586,079	V551I	probably benign	Het
Diaph3	C	T	14: 86,986,037	C347Y	probably damaging	Het
Dnajb5	A	G	4: 42,950,842		probably benign	Het
Dscam	A	T	16: 96,717,996	I847K	possibly damaging	Het
Fam8a1	T	C	13: 46,671,266	F243S	probably damaging	Het
Fat2	T	C	11: 55,284,752	I1712V	possibly damaging	Het
Fgfr1	T	C	8: 25,573,836	V793A	probably damaging	Het
Got2	T	C	8: 95,872,186	E196G	probably benign	Het
Gsk3b	G	A	16: 38,170,701	C107Y	possibly damaging	Het
H2-M5	T	C	17: 36,987,805	T250A	possibly damaging	Het
Il17f	T	A	1: 20,777,802	T151S	probably damaging	Het
Ints12	A	G	3: 133,108,868	N279D	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kynu	T	A	2: 43,679,890	S395T	probably benign	Het
Llgl1	C	T	11: 60,706,321	T226I	probably benign	Het
Mael	T	A	1: 166,235,487	Q132L	probably damaging	Het
Mcpt1	A	T	14: 56,018,652	R49S	probably benign	Het
Meioc	G	T	11: 102,674,166	G203C	probably damaging	Het
Mfsd4b1	A	G	10: 40,007,317	S46P	probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mx2	C	A	16: 97,547,432	Y268*	probably null	Het
Myom1	A	G	17: 71,100,074	D1064G	possibly damaging	Het
Nek11	A	G	9: 105,392,847		probably null	Het
Nfe2	A	G	15: 103,248,805	L253S	probably damaging	Het
Nxpe2	T	C	9: 48,319,482	D529G	probably damaging	Het
Oard1	T	C	17: 48,415,239	S88P	possibly damaging	Het
Olfr1370	C	T	13: 21,072,522	V260I	probably benign	Het
Olfr231	G	T	1: 174,117,320	T232N	probably damaging	Het
Olfr639	T	C	7: 104,012,417	D95G	probably benign	Het
Olfr678	T	C	7: 105,069,590	V41A	probably benign	Het
Olfr732	G	A	14: 50,281,683	T190I	probably benign	Het
Olfr741	A	G	14: 50,486,162	R235G	probably benign	Het
Olfr906	A	C	9: 38,488,761	H244P	probably damaging	Het
Osgin1	C	T	8: 119,445,253	T262I	possibly damaging	Het
Plcb4	A	T	2: 136,002,599	M146L	probably damaging	Het
Prkdc	A	T	16: 15,767,966	E2456V	possibly damaging	Het
Ptk2	G	A	15: 73,206,196	A1004V	probably damaging	Het
Rab15	G	A	12: 76,800,671		probably benign	Het
Rad51ap2	T	C	12: 11,457,880	V601A	probably benign	Het
Rasef	T	A	4: 73,780,389	I12F	possibly damaging	Het
Rdh14	T	A	12: 10,394,567	N139K	probably damaging	Het
Rexo2	A	T	9: 48,480,417	V46E	probably damaging	Het
Slmap	A	T	14: 26,465,617	L68H	probably damaging	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Tmem132e	T	C	11: 82,435,068	I206T	possibly damaging	Het
Trappc8	A	T	18: 20,836,948	V995E	probably benign	Het
Vmn2r12	A	C	5: 109,086,435	I637S	probably damaging	Het
Vmn2r124	T	C	17: 18,073,969	F773L	probably damaging	Het
Vmn2r99	A	T	17: 19,393,662	D548V	probably damaging	Het
Wdr81	T	C	11: 75,445,794	N1590D	probably benign	Het
Zbtb6	A	T	2: 37,429,042	N291K	possibly damaging	Het
Zfp119a	G	A	17: 55,866,325	R173C	probably benign	Het
Zmynd15	T	C	11: 70,464,182	L335P	probably damaging	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.34
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	intron	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7924:Nup205	UTSW	6	35247437	missense	unknown
R8073:Nup205	UTSW	6	35202169	critical splice donor site	unknown
Z1177:Nup205	UTSW	6	35177605	missense	not run
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	unknown

Predicted Primers

PCR Primer
(F):5'- ATTGAACCATCTCCCTGGC -3'
(R):5'- ATACAGTTCACCAATCTGCAGAG -3'

Sequencing Primer
(F):5'- GGCTCTCTCTGATCCTTAAGATAC -3'
(R):5'- GTTCACCAATCTGCAGAGAATAAG -3'

Posted On

2015-09-25