Mutagenetix > Incidental Mutation

Incidental Mutation 'R4594:Olfr639'

344256

Institutional Source

Beutler Lab

Gene Symbol

Olfr639

Ensembl Gene

ENSMUSG00000066263

Gene Name

olfactory receptor 639

Synonyms

MOR12-1, GA_x6K02T2PBJ9-6747143-6746193

MMRRC Submission

041810-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R4594 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104006231-104017303 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104012417 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 95 (D95G)

Ref Sequence

ENSEMBL: ENSMUSP00000149743 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106862] [ENSMUST00000138055] [ENSMUST00000215653]

AlphaFold

Q8VGY8

Predicted Effect

probably benign
Transcript: ENSMUST00000106862
AA Change: D95G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000102475
Gene: ENSMUSG00000066263
AA Change: D95G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	312	1.4e-120	PFAM
Pfam:7TM_GPCR_Srsx	37	173	3.6e-9	PFAM
Pfam:7tm_1	43	294	4.9e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000138055

SMART Domains

Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215653
AA Change: D95G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,575,754	T64A	probably damaging	Het
4933427I04Rik	A	T	4: 123,860,538	T82S	possibly damaging	Het
Adamts15	A	T	9: 30,921,447	I264N	probably damaging	Het
Alpk1	G	A	3: 127,683,554	A285V	probably damaging	Het
Auh	T	C	13: 52,912,966		probably benign	Het
BC030499	T	A	11: 78,291,647	V94D	possibly damaging	Het
Cacna2d3	A	G	14: 28,982,346	F826S	probably benign	Het
Ccdc54	G	T	16: 50,590,017	Y295*	probably null	Het
Ctnna3	G	A	10: 64,586,079	V551I	probably benign	Het
Diaph3	C	T	14: 86,986,037	C347Y	probably damaging	Het
Dnajb5	A	G	4: 42,950,842		probably benign	Het
Dscam	A	T	16: 96,717,996	I847K	possibly damaging	Het
Fam8a1	T	C	13: 46,671,266	F243S	probably damaging	Het
Fat2	T	C	11: 55,284,752	I1712V	possibly damaging	Het
Fgfr1	T	C	8: 25,573,836	V793A	probably damaging	Het
Got2	T	C	8: 95,872,186	E196G	probably benign	Het
Gsk3b	G	A	16: 38,170,701	C107Y	possibly damaging	Het
H2-M5	T	C	17: 36,987,805	T250A	possibly damaging	Het
Il17f	T	A	1: 20,777,802	T151S	probably damaging	Het
Ints12	A	G	3: 133,108,868	N279D	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kynu	T	A	2: 43,679,890	S395T	probably benign	Het
Llgl1	C	T	11: 60,706,321	T226I	probably benign	Het
Mael	T	A	1: 166,235,487	Q132L	probably damaging	Het
Mcpt1	A	T	14: 56,018,652	R49S	probably benign	Het
Meioc	G	T	11: 102,674,166	G203C	probably damaging	Het
Mfsd4b1	A	G	10: 40,007,317	S46P	probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mx2	C	A	16: 97,547,432	Y268*	probably null	Het
Myom1	A	G	17: 71,100,074	D1064G	possibly damaging	Het
Nek11	A	G	9: 105,392,847		probably null	Het
Nfe2	A	G	15: 103,248,805	L253S	probably damaging	Het
Nup205	T	C	6: 35,196,489	I478T	probably benign	Het
Nxpe2	T	C	9: 48,319,482	D529G	probably damaging	Het
Oard1	T	C	17: 48,415,239	S88P	possibly damaging	Het
Olfr1370	C	T	13: 21,072,522	V260I	probably benign	Het
Olfr231	G	T	1: 174,117,320	T232N	probably damaging	Het
Olfr678	T	C	7: 105,069,590	V41A	probably benign	Het
Olfr732	G	A	14: 50,281,683	T190I	probably benign	Het
Olfr741	A	G	14: 50,486,162	R235G	probably benign	Het
Olfr906	A	C	9: 38,488,761	H244P	probably damaging	Het
Osgin1	C	T	8: 119,445,253	T262I	possibly damaging	Het
Plcb4	A	T	2: 136,002,599	M146L	probably damaging	Het
Prkdc	A	T	16: 15,767,966	E2456V	possibly damaging	Het
Ptk2	G	A	15: 73,206,196	A1004V	probably damaging	Het
Rab15	G	A	12: 76,800,671		probably benign	Het
Rad51ap2	T	C	12: 11,457,880	V601A	probably benign	Het
Rasef	T	A	4: 73,780,389	I12F	possibly damaging	Het
Rdh14	T	A	12: 10,394,567	N139K	probably damaging	Het
Rexo2	A	T	9: 48,480,417	V46E	probably damaging	Het
Slmap	A	T	14: 26,465,617	L68H	probably damaging	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Tmem132e	T	C	11: 82,435,068	I206T	possibly damaging	Het
Trappc8	A	T	18: 20,836,948	V995E	probably benign	Het
Vmn2r12	A	C	5: 109,086,435	I637S	probably damaging	Het
Vmn2r124	T	C	17: 18,073,969	F773L	probably damaging	Het
Vmn2r99	A	T	17: 19,393,662	D548V	probably damaging	Het
Wdr81	T	C	11: 75,445,794	N1590D	probably benign	Het
Zbtb6	A	T	2: 37,429,042	N291K	possibly damaging	Het
Zfp119a	G	A	17: 55,866,325	R173C	probably benign	Het
Zmynd15	T	C	11: 70,464,182	L335P	probably damaging	Het

Other mutations in Olfr639

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Olfr639	APN	7	104012114	missense	probably damaging	1.00
IGL01547:Olfr639	APN	7	104012660	missense	probably benign	0.43
IGL02173:Olfr639	APN	7	104011830	missense	probably damaging	1.00
IGL02707:Olfr639	APN	7	104012402	missense	probably damaging	1.00
IGL03124:Olfr639	APN	7	104011794	missense	probably benign
R0004:Olfr639	UTSW	7	104012431	missense	probably benign	0.02
R0086:Olfr639	UTSW	7	104012054	missense	probably benign	0.23
R0370:Olfr639	UTSW	7	104012059	missense	probably damaging	0.99
R0599:Olfr639	UTSW	7	104012188	nonsense	probably null
R1351:Olfr639	UTSW	7	104012316	missense	possibly damaging	0.81
R1604:Olfr639	UTSW	7	104011955	missense	probably damaging	1.00
R2314:Olfr639	UTSW	7	104012229	missense	probably benign	0.09
R2656:Olfr639	UTSW	7	104011865	missense	probably damaging	0.96
R4774:Olfr639	UTSW	7	104012588	missense	probably benign	0.00
R4945:Olfr639	UTSW	7	104012378	missense	possibly damaging	0.85
R4968:Olfr639	UTSW	7	104012570	missense	probably damaging	1.00
R4981:Olfr639	UTSW	7	104012105	missense	probably damaging	0.97
R5072:Olfr639	UTSW	7	104012118	missense	probably damaging	0.97
R5982:Olfr639	UTSW	7	104011910	missense	probably damaging	1.00
R6303:Olfr639	UTSW	7	104012031	missense	probably damaging	1.00
R6304:Olfr639	UTSW	7	104012031	missense	probably damaging	1.00
R6332:Olfr639	UTSW	7	104011773	missense	probably benign	0.00
R7107:Olfr639	UTSW	7	104012282	missense	probably benign	0.16
R7152:Olfr639	UTSW	7	104012019	missense	probably benign
R7456:Olfr639	UTSW	7	104011838	missense	possibly damaging	0.83
R7849:Olfr639	UTSW	7	104012303	missense	possibly damaging	0.56
R8023:Olfr639	UTSW	7	104011799	missense	probably damaging	0.97
R8082:Olfr639	UTSW	7	104012690	missense	probably benign	0.04
R8215:Olfr639	UTSW	7	104012123	missense	possibly damaging	0.85
R8428:Olfr639	UTSW	7	104012425	nonsense	probably null
R8985:Olfr639	UTSW	7	104012160	missense	probably damaging	1.00
R9261:Olfr639	UTSW	7	104012129	missense	probably damaging	1.00
Z1177:Olfr639	UTSW	7	104012150	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTTTAAAAGAATTGGAAGTGGGGCC -3'
(R):5'- ACATGGCTGGCTCTCCATTC -3'

Sequencing Primer
(F):5'- TGGGGCCATGAGTGCAAC -3'
(R):5'- CATCATGTACATTGTTGCCATTGTG -3'

Posted On

2015-09-25