Incidental Mutation 'R4594:Got2'
ID344259
Institutional Source Beutler Lab
Gene Symbol Got2
Ensembl Gene ENSMUSG00000031672
Gene Nameglutamatic-oxaloacetic transaminase 2, mitochondrial
SynonymsFABP-pm, Got-2, plasma membrane fatty acid binding protein, mitochondrial aspartate aminotransferase, mAspAT
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R4594 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95864134-95888547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95872186 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 196 (E196G)
Ref Sequence ENSEMBL: ENSMUSP00000034097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034097]
AlphaFold P05202
PDB Structure Crystal Structure of Mouse Mitochondrial Aspartate Aminotransferase/Kynurenine Aminotransferase IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase, a newly identified kynurenine aminotransferase-IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase in complex with oxaloacetic acid [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034097
AA Change: E196G

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034097
Gene: ENSMUSG00000031672
AA Change: E196G

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:Aminotran_1_2 57 425 4.8e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212190
Meta Mutation Damage Score 0.3026 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and inner-membrane mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Got2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Got2 APN 8 95872201 missense probably benign 0.06
Toothpick UTSW 8 95872268 missense probably benign 0.20
R0189:Got2 UTSW 8 95888253 missense probably benign 0.11
R0254:Got2 UTSW 8 95869538 missense probably benign 0.03
R1450:Got2 UTSW 8 95871986 missense probably benign 0.00
R1552:Got2 UTSW 8 95869494 missense probably benign 0.22
R2495:Got2 UTSW 8 95888290 missense possibly damaging 0.81
R3946:Got2 UTSW 8 95888230 missense probably benign
R4021:Got2 UTSW 8 95877753 missense probably damaging 1.00
R5087:Got2 UTSW 8 95872323 missense probably benign 0.00
R5233:Got2 UTSW 8 95875849 missense probably benign 0.33
R6156:Got2 UTSW 8 95872268 missense probably benign 0.20
R6529:Got2 UTSW 8 95888385 start gained probably benign
R8481:Got2 UTSW 8 95888524 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GACACTCTGCTCTGGGATTTTC -3'
(R):5'- TCCTCTCAGGAAAGCATTAGC -3'

Sequencing Primer
(F):5'- GAAACAATCGAGATTTTTGGCTGTGC -3'
(R):5'- CCTCTCAGGAAAGCATTAGCATTTTG -3'
Posted On2015-09-25