Incidental Mutation 'R4594:Olfr906'
ID 344262
Institutional Source Beutler Lab
Gene Symbol Olfr906
Ensembl Gene ENSMUSG00000039962
Gene Name olfactory receptor 906
Synonyms MOR167-2, GA_x6K02T2PVTD-32194085-32195020
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R4594 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 38487085-38491560 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 38488761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 244 (H244P)
Ref Sequence ENSEMBL: ENSMUSP00000151008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045493] [ENSMUST00000214344]
AlphaFold K7N5P3
Predicted Effect probably damaging
Transcript: ENSMUST00000045493
AA Change: H244P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039040
Gene: ENSMUSG00000039962
AA Change: H244P

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 3.6e-50 PFAM
Pfam:7tm_1 41 290 2.1e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214344
AA Change: H244P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Olfr906
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03127:Olfr906 APN 9 38488586 missense probably benign 0.13
R0948:Olfr906 UTSW 9 38488948 missense probably benign 0.00
R1236:Olfr906 UTSW 9 38488229 missense probably damaging 1.00
R1246:Olfr906 UTSW 9 38488790 missense probably damaging 1.00
R1442:Olfr906 UTSW 9 38488643 missense probably benign 0.10
R2016:Olfr906 UTSW 9 38488013 critical splice acceptor site probably null
R2264:Olfr906 UTSW 9 38488055 missense possibly damaging 0.50
R2268:Olfr906 UTSW 9 38488208 missense probably damaging 1.00
R3853:Olfr906 UTSW 9 38488951 missense probably benign 0.18
R4066:Olfr906 UTSW 9 38488482 missense probably benign 0.17
R5192:Olfr906 UTSW 9 38488805 missense possibly damaging 0.69
R5436:Olfr906 UTSW 9 38488539 missense probably benign 0.31
R5598:Olfr906 UTSW 9 38488525 missense possibly damaging 0.77
R5694:Olfr906 UTSW 9 38488236 missense probably damaging 1.00
R5914:Olfr906 UTSW 9 38488361 missense probably damaging 1.00
R5959:Olfr906 UTSW 9 38488911 missense probably damaging 1.00
R6318:Olfr906 UTSW 9 38488377 missense probably benign
R6870:Olfr906 UTSW 9 38488086 missense probably benign 0.19
R7482:Olfr906 UTSW 9 38488451 missense probably damaging 0.99
R7571:Olfr906 UTSW 9 38488656 missense probably benign 0.08
R7917:Olfr906 UTSW 9 38488609 nonsense probably null
R8837:Olfr906 UTSW 9 38488301 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGTGACATCCTCCCTGTGATG -3'
(R):5'- TACCATAGTTTCCACCTACTCAAG -3'

Sequencing Primer
(F):5'- CTGTGATGCAGCTCTCCTG -3'
(R):5'- ACTCAAGGTTATCCTCAGGGC -3'
Posted On 2015-09-25