Incidental Mutation 'R4594:Nxpe2'
ID 344263
Institutional Source Beutler Lab
Gene Symbol Nxpe2
Ensembl Gene ENSMUSG00000032028
Gene Name neurexophilin and PC-esterase domain family, member 2
Synonyms Fam55b, 4432416J03Rik
MMRRC Submission 041810-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R4594 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 48229303-48264749 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48230782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 529 (D529G)
Ref Sequence ENSEMBL: ENSMUSP00000034527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034527] [ENSMUST00000135457] [ENSMUST00000215780] [ENSMUST00000216998]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000034527
AA Change: D529G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034527
Gene: ENSMUSG00000032028
AA Change: D529G

DomainStartEndE-ValueType
transmembrane domain 22 39 N/A INTRINSIC
Pfam:Neurexophilin 80 277 1.2e-18 PFAM
low complexity region 307 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135457
Predicted Effect probably benign
Transcript: ENSMUST00000215780
Predicted Effect probably benign
Transcript: ENSMUST00000216998
Meta Mutation Damage Score 0.8280 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,625,754 (GRCm39) T64A probably damaging Het
4933427I04Rik A T 4: 123,754,331 (GRCm39) T82S possibly damaging Het
Adamts15 A T 9: 30,832,743 (GRCm39) I264N probably damaging Het
Alpk1 G A 3: 127,477,203 (GRCm39) A285V probably damaging Het
Auh T C 13: 53,067,002 (GRCm39) probably benign Het
Cacna2d3 A G 14: 28,704,303 (GRCm39) F826S probably benign Het
Ccdc54 G T 16: 50,410,380 (GRCm39) Y295* probably null Het
Ctnna3 G A 10: 64,421,858 (GRCm39) V551I probably benign Het
Diaph3 C T 14: 87,223,473 (GRCm39) C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 (GRCm39) probably benign Het
Dscam A T 16: 96,519,196 (GRCm39) I847K possibly damaging Het
Fam8a1 T C 13: 46,824,742 (GRCm39) F243S probably damaging Het
Fat2 T C 11: 55,175,578 (GRCm39) I1712V possibly damaging Het
Fgfr1 T C 8: 26,063,852 (GRCm39) V793A probably damaging Het
Got2 T C 8: 96,598,814 (GRCm39) E196G probably benign Het
Gsk3b G A 16: 37,991,063 (GRCm39) C107Y possibly damaging Het
H2-M5 T C 17: 37,298,697 (GRCm39) T250A possibly damaging Het
Il17f T A 1: 20,848,026 (GRCm39) T151S probably damaging Het
Ints12 A G 3: 132,814,629 (GRCm39) N279D probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kynu T A 2: 43,569,902 (GRCm39) S395T probably benign Het
Llgl1 C T 11: 60,597,147 (GRCm39) T226I probably benign Het
Mael T A 1: 166,063,056 (GRCm39) Q132L probably damaging Het
Mcpt1 A T 14: 56,256,109 (GRCm39) R49S probably benign Het
Meioc G T 11: 102,564,992 (GRCm39) G203C probably damaging Het
Mfsd4b1 A G 10: 39,883,313 (GRCm39) S46P probably benign Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Mx2 C A 16: 97,348,632 (GRCm39) Y268* probably null Het
Myom1 A G 17: 71,407,069 (GRCm39) D1064G possibly damaging Het
Nek11 A G 9: 105,270,046 (GRCm39) probably null Het
Nfe2 A G 15: 103,157,232 (GRCm39) L253S probably damaging Het
Nup205 T C 6: 35,173,424 (GRCm39) I478T probably benign Het
Oard1 T C 17: 48,722,267 (GRCm39) S88P possibly damaging Het
Or11g25 A G 14: 50,723,619 (GRCm39) R235G probably benign Het
Or2p2 C T 13: 21,256,692 (GRCm39) V260I probably benign Het
Or4n4 G A 14: 50,519,140 (GRCm39) T190I probably benign Het
Or51k1 T C 7: 103,661,624 (GRCm39) D95G probably benign Het
Or52e5 T C 7: 104,718,797 (GRCm39) V41A probably benign Het
Or6k6 G T 1: 173,944,886 (GRCm39) T232N probably damaging Het
Or8b1 A C 9: 38,400,057 (GRCm39) H244P probably damaging Het
Osgin1 C T 8: 120,171,992 (GRCm39) T262I possibly damaging Het
Plcb4 A T 2: 135,844,519 (GRCm39) M146L probably damaging Het
Prkdc A T 16: 15,585,830 (GRCm39) E2456V possibly damaging Het
Ptk2 G A 15: 73,078,045 (GRCm39) A1004V probably damaging Het
Rab15 G A 12: 76,847,445 (GRCm39) probably benign Het
Rad51ap2 T C 12: 11,507,881 (GRCm39) V601A probably benign Het
Rasef T A 4: 73,698,626 (GRCm39) I12F possibly damaging Het
Rdh14 T A 12: 10,444,567 (GRCm39) N139K probably damaging Het
Rexo2 A T 9: 48,391,717 (GRCm39) V46E probably damaging Het
Rskr T A 11: 78,182,473 (GRCm39) V94D possibly damaging Het
Slmap A T 14: 26,186,772 (GRCm39) L68H probably damaging Het
Speer3 C G 5: 13,846,394 (GRCm39) A238G possibly damaging Het
Tmem132e T C 11: 82,325,894 (GRCm39) I206T possibly damaging Het
Trappc8 A T 18: 20,970,005 (GRCm39) V995E probably benign Het
Vmn2r12 A C 5: 109,234,301 (GRCm39) I637S probably damaging Het
Vmn2r124 T C 17: 18,294,231 (GRCm39) F773L probably damaging Het
Vmn2r99 A T 17: 19,613,924 (GRCm39) D548V probably damaging Het
Wdr81 T C 11: 75,336,620 (GRCm39) N1590D probably benign Het
Zbtb6 A T 2: 37,319,054 (GRCm39) N291K possibly damaging Het
Zfp119a G A 17: 56,173,325 (GRCm39) R173C probably benign Het
Zmynd15 T C 11: 70,355,008 (GRCm39) L335P probably damaging Het
Other mutations in Nxpe2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Nxpe2 APN 9 48,231,923 (GRCm39) missense probably benign 0.00
IGL01830:Nxpe2 APN 9 48,237,794 (GRCm39) missense probably damaging 1.00
IGL02039:Nxpe2 APN 9 48,230,959 (GRCm39) missense probably benign 0.11
IGL02618:Nxpe2 APN 9 48,237,634 (GRCm39) missense probably damaging 1.00
IGL03065:Nxpe2 APN 9 48,230,992 (GRCm39) missense possibly damaging 0.68
IGL03128:Nxpe2 APN 9 48,230,798 (GRCm39) missense probably benign 0.12
P4717OSA:Nxpe2 UTSW 9 48,237,677 (GRCm39) missense probably benign 0.08
R0019:Nxpe2 UTSW 9 48,231,080 (GRCm39) missense probably benign 0.37
R0172:Nxpe2 UTSW 9 48,231,209 (GRCm39) missense possibly damaging 0.76
R0255:Nxpe2 UTSW 9 48,251,870 (GRCm39) critical splice donor site probably null
R0415:Nxpe2 UTSW 9 48,237,914 (GRCm39) missense probably damaging 0.99
R1061:Nxpe2 UTSW 9 48,237,663 (GRCm39) missense probably damaging 1.00
R1248:Nxpe2 UTSW 9 48,231,211 (GRCm39) missense possibly damaging 0.46
R1311:Nxpe2 UTSW 9 48,237,914 (GRCm39) missense probably damaging 0.99
R1393:Nxpe2 UTSW 9 48,237,914 (GRCm39) missense probably damaging 0.99
R1827:Nxpe2 UTSW 9 48,237,914 (GRCm39) missense probably damaging 0.99
R1828:Nxpe2 UTSW 9 48,237,914 (GRCm39) missense probably damaging 0.99
R1831:Nxpe2 UTSW 9 48,237,452 (GRCm39) missense probably benign 0.01
R1866:Nxpe2 UTSW 9 48,238,121 (GRCm39) missense probably benign 0.01
R1889:Nxpe2 UTSW 9 48,237,914 (GRCm39) missense probably damaging 0.99
R1892:Nxpe2 UTSW 9 48,237,914 (GRCm39) missense probably damaging 0.99
R1903:Nxpe2 UTSW 9 48,230,906 (GRCm39) missense probably benign 0.40
R1928:Nxpe2 UTSW 9 48,237,914 (GRCm39) missense probably damaging 0.99
R1959:Nxpe2 UTSW 9 48,231,026 (GRCm39) missense probably benign 0.06
R4697:Nxpe2 UTSW 9 48,231,821 (GRCm39) missense probably benign 0.03
R4909:Nxpe2 UTSW 9 48,230,897 (GRCm39) missense possibly damaging 0.93
R5048:Nxpe2 UTSW 9 48,237,388 (GRCm39) splice site probably null
R5372:Nxpe2 UTSW 9 48,250,819 (GRCm39) missense possibly damaging 0.66
R5614:Nxpe2 UTSW 9 48,234,401 (GRCm39) missense probably benign 0.30
R5762:Nxpe2 UTSW 9 48,230,875 (GRCm39) missense probably benign 0.02
R6151:Nxpe2 UTSW 9 48,237,491 (GRCm39) missense probably benign 0.01
R6958:Nxpe2 UTSW 9 48,237,566 (GRCm39) missense probably damaging 1.00
R7130:Nxpe2 UTSW 9 48,250,837 (GRCm39) missense probably benign 0.00
R7138:Nxpe2 UTSW 9 48,232,006 (GRCm39) missense probably damaging 1.00
R7250:Nxpe2 UTSW 9 48,238,096 (GRCm39) missense possibly damaging 0.77
R7289:Nxpe2 UTSW 9 48,234,339 (GRCm39) critical splice donor site probably null
R7949:Nxpe2 UTSW 9 48,234,397 (GRCm39) missense possibly damaging 0.83
R7973:Nxpe2 UTSW 9 48,231,168 (GRCm39) missense probably damaging 0.99
R8327:Nxpe2 UTSW 9 48,231,059 (GRCm39) missense probably benign 0.01
R8725:Nxpe2 UTSW 9 48,238,073 (GRCm39) missense probably benign 0.01
R8727:Nxpe2 UTSW 9 48,238,073 (GRCm39) missense probably benign 0.01
R9085:Nxpe2 UTSW 9 48,250,872 (GRCm39) missense probably benign 0.11
R9577:Nxpe2 UTSW 9 48,237,632 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCATGCAAGTACCTATGAG -3'
(R):5'- TTTTGGTCAACACTTCAGACCC -3'

Sequencing Primer
(F):5'- TGCATGCAAGTACCTATGAGATCAG -3'
(R):5'- CGTAGGGCCATCAACGTC -3'
Posted On 2015-09-25