Incidental Mutation 'R4594:Nek11'
ID344265
Institutional Source Beutler Lab
Gene Symbol Nek11
Ensembl Gene ENSMUSG00000035032
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 11
Synonyms4932416N14Rik
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4594 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location105162156-105395524 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 105392847 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035181] [ENSMUST00000038648] [ENSMUST00000123807] [ENSMUST00000140851] [ENSMUST00000140851] [ENSMUST00000156256] [ENSMUST00000176350] [ENSMUST00000176940] [ENSMUST00000177029] [ENSMUST00000177402] [ENSMUST00000189758]
Predicted Effect probably benign
Transcript: ENSMUST00000035181
SMART Domains Protein: ENSMUSP00000035181
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
Pfam:XPG_I_2 115 307 1e-18 PFAM
low complexity region 476 488 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000038648
SMART Domains Protein: ENSMUSP00000038611
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
coiled coil region 348 384 N/A INTRINSIC
low complexity region 408 423 N/A INTRINSIC
low complexity region 450 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123807
Predicted Effect probably benign
Transcript: ENSMUST00000123807
Predicted Effect probably null
Transcript: ENSMUST00000140851
SMART Domains Protein: ENSMUSP00000116864
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140851
SMART Domains Protein: ENSMUSP00000116864
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
S_TKc 30 288 3.87e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156256
SMART Domains Protein: ENSMUSP00000116761
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
Pfam:Pkinase 30 177 8.9e-36 PFAM
Pfam:Pkinase_Tyr 30 178 8.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176597
Predicted Effect probably benign
Transcript: ENSMUST00000176940
Predicted Effect probably benign
Transcript: ENSMUST00000177029
SMART Domains Protein: ENSMUSP00000135837
Gene: ENSMUSG00000035032

DomainStartEndE-ValueType
SCOP:d1h8fa_ 11 80 1e-6 SMART
Blast:S_TKc 30 70 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177402
SMART Domains Protein: ENSMUSP00000135318
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189758
SMART Domains Protein: ENSMUSP00000139854
Gene: ENSMUSG00000032567

DomainStartEndE-ValueType
low complexity region 59 71 N/A INTRINSIC
Meta Mutation Damage Score 0.9490 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the never in mitosis gene A family of kinases. The encoded protein localizes to the nucleoli, and may function with NEK2A in the S-phase checkpoint. The encoded protein appears to play roles in DNA replication and response to genotoxic stress. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Nek11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Nek11 APN 9 105392913 missense probably damaging 1.00
IGL01369:Nek11 APN 9 105300060 critical splice donor site probably null
IGL01958:Nek11 APN 9 105300303 missense probably benign 0.06
IGL03099:Nek11 APN 9 105287653 missense probably benign 0.02
IGL03256:Nek11 APN 9 105244414 missense probably damaging 1.00
IGL03400:Nek11 APN 9 105204866 missense probably benign 0.01
R0051:Nek11 UTSW 9 105218539 splice site probably benign
R0051:Nek11 UTSW 9 105218539 splice site probably benign
R0194:Nek11 UTSW 9 105392952 missense probably benign 0.05
R0942:Nek11 UTSW 9 105295371 splice site probably null
R1226:Nek11 UTSW 9 105392892 missense probably damaging 1.00
R1503:Nek11 UTSW 9 105163204 missense probably damaging 1.00
R1709:Nek11 UTSW 9 105348061 missense probably damaging 1.00
R1958:Nek11 UTSW 9 105293717 missense probably benign 0.00
R2128:Nek11 UTSW 9 105300361 missense probably benign 0.01
R3754:Nek11 UTSW 9 105314718 missense probably damaging 1.00
R4027:Nek11 UTSW 9 105244390 nonsense probably null
R4650:Nek11 UTSW 9 105348080 missense possibly damaging 0.79
R4724:Nek11 UTSW 9 105392970 missense possibly damaging 0.89
R4846:Nek11 UTSW 9 105163163 missense probably damaging 1.00
R4903:Nek11 UTSW 9 105314722 missense possibly damaging 0.63
R4908:Nek11 UTSW 9 105298289 missense probably benign 0.00
R4912:Nek11 UTSW 9 105287658 missense probably benign 0.01
R4930:Nek11 UTSW 9 105300066 missense probably damaging 1.00
R5827:Nek11 UTSW 9 105314745 missense probably damaging 1.00
R5860:Nek11 UTSW 9 105392961 missense probably benign 0.01
R6030:Nek11 UTSW 9 105204888 critical splice acceptor site probably null
R6030:Nek11 UTSW 9 105204888 critical splice acceptor site probably null
R6154:Nek11 UTSW 9 105323169 makesense probably null
R6915:Nek11 UTSW 9 105393057 unclassified probably benign
R7197:Nek11 UTSW 9 105244415 missense probably damaging 1.00
R8059:Nek11 UTSW 9 105162974 makesense probably null
R8140:Nek11 UTSW 9 105392957 missense probably damaging 0.99
R8357:Nek11 UTSW 9 105347992 missense probably damaging 1.00
R8457:Nek11 UTSW 9 105347992 missense probably damaging 1.00
R8536:Nek11 UTSW 9 105298339 missense probably benign 0.04
Z1176:Nek11 UTSW 9 105293669 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TTTAAAAGCAAAGCCCTGTGAC -3'
(R):5'- GCCCAACTGTTGTTTCTGTG -3'

Sequencing Primer
(F):5'- GCCCTGTGACTTCAAGTAAAATGG -3'
(R):5'- GTTTGGAGCAATGCTGAAATTCC -3'
Posted On2015-09-25