Mutagenetix > Incidental Mutations

Incidental Mutation 'R4594:Llgl1'

344269

Institutional Source

Beutler Lab

Gene Symbol

Llgl1

Ensembl Gene

ENSMUSG00000020536

Gene Name

LLGL1 scribble cell polarity complex component

Synonyms

Lgl1

MMRRC Submission

041810-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4594 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60699723-60714186 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 60706321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 226 (T226I)

Ref Sequence

ENSEMBL: ENSMUSP00000104359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052346] [ENSMUST00000108719]

AlphaFold

Q80Y17

Predicted Effect

probably benign
Transcript: ENSMUST00000052346
AA Change: T226I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: T226I

Domain	Start	End	E-Value	Type
WD40	22	62	4.42e1	SMART
WD40	64	103	1.65e1	SMART
WD40	187	223	2.74e2	SMART
WD40	226	264	2.06e0	SMART
Pfam:LLGL	278	379	1.2e-43	PFAM
WD40	424	460	3.2e0	SMART
Blast:WD40	498	541	2e-13	BLAST
Blast:WD40	585	624	4e-9	BLAST
Pfam:Lgl_C	732	978	1.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108719
AA Change: T226I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536
AA Change: T226I

Domain	Start	End	E-Value	Type
WD40	22	62	4.42e1	SMART
WD40	64	103	1.65e1	SMART
WD40	187	223	2.74e2	SMART
WD40	226	264	2.06e0	SMART
Pfam:LLGL	275	379	2e-48	PFAM
WD40	424	460	3.2e0	SMART
Blast:WD40	498	540	2e-13	BLAST
Blast:WD40	585	624	4e-9	BLAST
Pfam:Lgl_C	804	976	1.3e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128749

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,575,754	T64A	probably damaging	Het
4933427I04Rik	A	T	4: 123,860,538	T82S	possibly damaging	Het
Adamts15	A	T	9: 30,921,447	I264N	probably damaging	Het
Alpk1	G	A	3: 127,683,554	A285V	probably damaging	Het
Auh	T	C	13: 52,912,966		probably benign	Het
BC030499	T	A	11: 78,291,647	V94D	possibly damaging	Het
Cacna2d3	A	G	14: 28,982,346	F826S	probably benign	Het
Ccdc54	G	T	16: 50,590,017	Y295*	probably null	Het
Ctnna3	G	A	10: 64,586,079	V551I	probably benign	Het
Diaph3	C	T	14: 86,986,037	C347Y	probably damaging	Het
Dnajb5	A	G	4: 42,950,842		probably benign	Het
Dscam	A	T	16: 96,717,996	I847K	possibly damaging	Het
Fam8a1	T	C	13: 46,671,266	F243S	probably damaging	Het
Fat2	T	C	11: 55,284,752	I1712V	possibly damaging	Het
Fgfr1	T	C	8: 25,573,836	V793A	probably damaging	Het
Got2	T	C	8: 95,872,186	E196G	probably benign	Het
Gsk3b	G	A	16: 38,170,701	C107Y	possibly damaging	Het
H2-M5	T	C	17: 36,987,805	T250A	possibly damaging	Het
Il17f	T	A	1: 20,777,802	T151S	probably damaging	Het
Ints12	A	G	3: 133,108,868	N279D	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kynu	T	A	2: 43,679,890	S395T	probably benign	Het
Mael	T	A	1: 166,235,487	Q132L	probably damaging	Het
Mcpt1	A	T	14: 56,018,652	R49S	probably benign	Het
Meioc	G	T	11: 102,674,166	G203C	probably damaging	Het
Mfsd4b1	A	G	10: 40,007,317	S46P	probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mx2	C	A	16: 97,547,432	Y268*	probably null	Het
Myom1	A	G	17: 71,100,074	D1064G	possibly damaging	Het
Nek11	A	G	9: 105,392,847		probably null	Het
Nfe2	A	G	15: 103,248,805	L253S	probably damaging	Het
Nup205	T	C	6: 35,196,489	I478T	probably benign	Het
Nxpe2	T	C	9: 48,319,482	D529G	probably damaging	Het
Oard1	T	C	17: 48,415,239	S88P	possibly damaging	Het
Olfr1370	C	T	13: 21,072,522	V260I	probably benign	Het
Olfr231	G	T	1: 174,117,320	T232N	probably damaging	Het
Olfr639	T	C	7: 104,012,417	D95G	probably benign	Het
Olfr678	T	C	7: 105,069,590	V41A	probably benign	Het
Olfr732	G	A	14: 50,281,683	T190I	probably benign	Het
Olfr741	A	G	14: 50,486,162	R235G	probably benign	Het
Olfr906	A	C	9: 38,488,761	H244P	probably damaging	Het
Osgin1	C	T	8: 119,445,253	T262I	possibly damaging	Het
Plcb4	A	T	2: 136,002,599	M146L	probably damaging	Het
Prkdc	A	T	16: 15,767,966	E2456V	possibly damaging	Het
Ptk2	G	A	15: 73,206,196	A1004V	probably damaging	Het
Rab15	G	A	12: 76,800,671		probably benign	Het
Rad51ap2	T	C	12: 11,457,880	V601A	probably benign	Het
Rasef	T	A	4: 73,780,389	I12F	possibly damaging	Het
Rdh14	T	A	12: 10,394,567	N139K	probably damaging	Het
Rexo2	A	T	9: 48,480,417	V46E	probably damaging	Het
Slmap	A	T	14: 26,465,617	L68H	probably damaging	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Tmem132e	T	C	11: 82,435,068	I206T	possibly damaging	Het
Trappc8	A	T	18: 20,836,948	V995E	probably benign	Het
Vmn2r12	A	C	5: 109,086,435	I637S	probably damaging	Het
Vmn2r124	T	C	17: 18,073,969	F773L	probably damaging	Het
Vmn2r99	A	T	17: 19,393,662	D548V	probably damaging	Het
Wdr81	T	C	11: 75,445,794	N1590D	probably benign	Het
Zbtb6	A	T	2: 37,429,042	N291K	possibly damaging	Het
Zfp119a	G	A	17: 55,866,325	R173C	probably benign	Het
Zmynd15	T	C	11: 70,464,182	L335P	probably damaging	Het

Other mutations in Llgl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01137:Llgl1	APN	11	60709999	missense	probably benign	0.38
IGL01400:Llgl1	APN	11	60706490	missense	probably damaging	1.00
IGL03066:Llgl1	APN	11	60706034	missense	possibly damaging	0.75
IGL03174:Llgl1	APN	11	60706210	missense	probably benign	0.15
IGL03306:Llgl1	APN	11	60711354	missense	possibly damaging	0.92
R0284:Llgl1	UTSW	11	60712141	missense	probably damaging	0.98
R1137:Llgl1	UTSW	11	60704733	missense	probably benign	0.01
R1432:Llgl1	UTSW	11	60708554	missense	probably damaging	1.00
R1769:Llgl1	UTSW	11	60707047	missense	probably damaging	1.00
R1786:Llgl1	UTSW	11	60707240	missense	probably benign	0.19
R1835:Llgl1	UTSW	11	60704730	missense	probably benign	0.00
R1943:Llgl1	UTSW	11	60706016	missense	probably benign
R2197:Llgl1	UTSW	11	60710039	missense	possibly damaging	0.62
R2510:Llgl1	UTSW	11	60710036	missense	probably damaging	1.00
R2568:Llgl1	UTSW	11	60708812	missense	probably damaging	1.00
R3690:Llgl1	UTSW	11	60707002	missense	probably damaging	1.00
R3853:Llgl1	UTSW	11	60707249	missense	probably damaging	1.00
R4079:Llgl1	UTSW	11	60710284	splice site	probably null
R4259:Llgl1	UTSW	11	60709568	missense	probably benign
R4348:Llgl1	UTSW	11	60709568	missense	probably benign
R4349:Llgl1	UTSW	11	60709568	missense	probably benign
R4352:Llgl1	UTSW	11	60709568	missense	probably benign
R4353:Llgl1	UTSW	11	60709568	missense	probably benign
R4396:Llgl1	UTSW	11	60706008	missense	probably benign
R4584:Llgl1	UTSW	11	60712082	missense	probably damaging	0.99
R4628:Llgl1	UTSW	11	60709985	missense	probably damaging	1.00
R4651:Llgl1	UTSW	11	60708651	missense	possibly damaging	0.80
R4653:Llgl1	UTSW	11	60708651	missense	possibly damaging	0.80
R4731:Llgl1	UTSW	11	60706225	nonsense	probably null
R4869:Llgl1	UTSW	11	60707210	nonsense	probably null
R4898:Llgl1	UTSW	11	60709568	missense	probably benign
R4899:Llgl1	UTSW	11	60709568	missense	probably benign
R4939:Llgl1	UTSW	11	60709979	critical splice acceptor site	probably null
R4941:Llgl1	UTSW	11	60709568	missense	probably benign
R4942:Llgl1	UTSW	11	60709568	missense	probably benign
R4958:Llgl1	UTSW	11	60711435	missense	probably benign	0.02
R4995:Llgl1	UTSW	11	60709724	missense	probably benign	0.00
R4997:Llgl1	UTSW	11	60709568	missense	probably benign
R5177:Llgl1	UTSW	11	60712007	missense	possibly damaging	0.94
R5257:Llgl1	UTSW	11	60711563	splice site	probably null
R5258:Llgl1	UTSW	11	60711563	splice site	probably null
R5401:Llgl1	UTSW	11	60706471	missense	probably benign
R5406:Llgl1	UTSW	11	60713184	missense	probably damaging	0.99
R5432:Llgl1	UTSW	11	60707623	missense	probably benign
R5587:Llgl1	UTSW	11	60710342	missense	probably benign	0.00
R5732:Llgl1	UTSW	11	60709460	missense	probably benign	0.00
R5758:Llgl1	UTSW	11	60708567	missense	probably damaging	1.00
R5879:Llgl1	UTSW	11	60712980	missense	probably benign	0.00
R6268:Llgl1	UTSW	11	60712163	missense	probably benign	0.13
R6286:Llgl1	UTSW	11	60709532	missense	probably damaging	1.00
R6455:Llgl1	UTSW	11	60709660	missense	probably damaging	0.98
R6805:Llgl1	UTSW	11	60702865	missense	probably benign	0.25
R6929:Llgl1	UTSW	11	60710353	nonsense	probably null
R7274:Llgl1	UTSW	11	60705986	missense	possibly damaging	0.89
R7889:Llgl1	UTSW	11	60707312	missense	probably damaging	1.00
R7986:Llgl1	UTSW	11	60711395	missense	probably benign	0.16
R8141:Llgl1	UTSW	11	60710316	missense	probably benign	0.02
R8176:Llgl1	UTSW	11	60706561	missense	probably benign	0.27
R8223:Llgl1	UTSW	11	60702822	missense	possibly damaging	0.86
R8332:Llgl1	UTSW	11	60710384	missense	possibly damaging	0.90
R8350:Llgl1	UTSW	11	60712121	missense	probably damaging	1.00
R8500:Llgl1	UTSW	11	60704983	critical splice donor site	probably null
R8979:Llgl1	UTSW	11	60710303	missense	probably benign	0.25
R9155:Llgl1	UTSW	11	60707108	missense	probably benign	0.00
R9163:Llgl1	UTSW	11	60709576	missense	probably benign	0.02
R9225:Llgl1	UTSW	11	60710063	missense	probably damaging	1.00
R9234:Llgl1	UTSW	11	60710130	critical splice donor site	probably null
Z1186:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1187:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1188:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1189:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1190:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1191:Llgl1	UTSW	11	60713097	frame shift	probably null
Z1192:Llgl1	UTSW	11	60713097	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCAGCCCAGATGTGGTTC -3'
(R):5'- CACTGTGTGAGCTGATAATGCTG -3'

Sequencing Primer
(F):5'- GAGGACCCTCCCATTTCTGG -3'
(R):5'- GAGCTGATAATGCTGCTGCCATC -3'

Posted On

2015-09-25