Incidental Mutation 'R4594:Llgl1'
ID 344269
Institutional Source Beutler Lab
Gene Symbol Llgl1
Ensembl Gene ENSMUSG00000020536
Gene Name LLGL1 scribble cell polarity complex component
Synonyms Lgl1
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4594 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 60699723-60714186 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 60706321 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 226 (T226I)
Ref Sequence ENSEMBL: ENSMUSP00000104359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052346] [ENSMUST00000108719]
AlphaFold Q80Y17
Predicted Effect probably benign
Transcript: ENSMUST00000052346
AA Change: T226I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: T226I

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 278 379 1.2e-43 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 541 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 732 978 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108719
AA Change: T226I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536
AA Change: T226I

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 275 379 2e-48 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 540 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 804 976 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128749
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Llgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Llgl1 APN 11 60709999 missense probably benign 0.38
IGL01400:Llgl1 APN 11 60706490 missense probably damaging 1.00
IGL03066:Llgl1 APN 11 60706034 missense possibly damaging 0.75
IGL03174:Llgl1 APN 11 60706210 missense probably benign 0.15
IGL03306:Llgl1 APN 11 60711354 missense possibly damaging 0.92
R0284:Llgl1 UTSW 11 60712141 missense probably damaging 0.98
R1137:Llgl1 UTSW 11 60704733 missense probably benign 0.01
R1432:Llgl1 UTSW 11 60708554 missense probably damaging 1.00
R1769:Llgl1 UTSW 11 60707047 missense probably damaging 1.00
R1786:Llgl1 UTSW 11 60707240 missense probably benign 0.19
R1835:Llgl1 UTSW 11 60704730 missense probably benign 0.00
R1943:Llgl1 UTSW 11 60706016 missense probably benign
R2197:Llgl1 UTSW 11 60710039 missense possibly damaging 0.62
R2510:Llgl1 UTSW 11 60710036 missense probably damaging 1.00
R2568:Llgl1 UTSW 11 60708812 missense probably damaging 1.00
R3690:Llgl1 UTSW 11 60707002 missense probably damaging 1.00
R3853:Llgl1 UTSW 11 60707249 missense probably damaging 1.00
R4079:Llgl1 UTSW 11 60710284 splice site probably null
R4259:Llgl1 UTSW 11 60709568 missense probably benign
R4348:Llgl1 UTSW 11 60709568 missense probably benign
R4349:Llgl1 UTSW 11 60709568 missense probably benign
R4352:Llgl1 UTSW 11 60709568 missense probably benign
R4353:Llgl1 UTSW 11 60709568 missense probably benign
R4396:Llgl1 UTSW 11 60706008 missense probably benign
R4584:Llgl1 UTSW 11 60712082 missense probably damaging 0.99
R4628:Llgl1 UTSW 11 60709985 missense probably damaging 1.00
R4651:Llgl1 UTSW 11 60708651 missense possibly damaging 0.80
R4653:Llgl1 UTSW 11 60708651 missense possibly damaging 0.80
R4731:Llgl1 UTSW 11 60706225 nonsense probably null
R4869:Llgl1 UTSW 11 60707210 nonsense probably null
R4898:Llgl1 UTSW 11 60709568 missense probably benign
R4899:Llgl1 UTSW 11 60709568 missense probably benign
R4939:Llgl1 UTSW 11 60709979 critical splice acceptor site probably null
R4941:Llgl1 UTSW 11 60709568 missense probably benign
R4942:Llgl1 UTSW 11 60709568 missense probably benign
R4958:Llgl1 UTSW 11 60711435 missense probably benign 0.02
R4995:Llgl1 UTSW 11 60709724 missense probably benign 0.00
R4997:Llgl1 UTSW 11 60709568 missense probably benign
R5177:Llgl1 UTSW 11 60712007 missense possibly damaging 0.94
R5257:Llgl1 UTSW 11 60711563 splice site probably null
R5258:Llgl1 UTSW 11 60711563 splice site probably null
R5401:Llgl1 UTSW 11 60706471 missense probably benign
R5406:Llgl1 UTSW 11 60713184 missense probably damaging 0.99
R5432:Llgl1 UTSW 11 60707623 missense probably benign
R5587:Llgl1 UTSW 11 60710342 missense probably benign 0.00
R5732:Llgl1 UTSW 11 60709460 missense probably benign 0.00
R5758:Llgl1 UTSW 11 60708567 missense probably damaging 1.00
R5879:Llgl1 UTSW 11 60712980 missense probably benign 0.00
R6268:Llgl1 UTSW 11 60712163 missense probably benign 0.13
R6286:Llgl1 UTSW 11 60709532 missense probably damaging 1.00
R6455:Llgl1 UTSW 11 60709660 missense probably damaging 0.98
R6805:Llgl1 UTSW 11 60702865 missense probably benign 0.25
R6929:Llgl1 UTSW 11 60710353 nonsense probably null
R7274:Llgl1 UTSW 11 60705986 missense possibly damaging 0.89
R7889:Llgl1 UTSW 11 60707312 missense probably damaging 1.00
R7986:Llgl1 UTSW 11 60711395 missense probably benign 0.16
R8141:Llgl1 UTSW 11 60710316 missense probably benign 0.02
R8176:Llgl1 UTSW 11 60706561 missense probably benign 0.27
R8223:Llgl1 UTSW 11 60702822 missense possibly damaging 0.86
R8332:Llgl1 UTSW 11 60710384 missense possibly damaging 0.90
R8350:Llgl1 UTSW 11 60712121 missense probably damaging 1.00
R8500:Llgl1 UTSW 11 60704983 critical splice donor site probably null
R8979:Llgl1 UTSW 11 60710303 missense probably benign 0.25
R9155:Llgl1 UTSW 11 60707108 missense probably benign 0.00
R9163:Llgl1 UTSW 11 60709576 missense probably benign 0.02
R9225:Llgl1 UTSW 11 60710063 missense probably damaging 1.00
R9234:Llgl1 UTSW 11 60710130 critical splice donor site probably null
Z1186:Llgl1 UTSW 11 60713097 frame shift probably null
Z1187:Llgl1 UTSW 11 60713097 frame shift probably null
Z1188:Llgl1 UTSW 11 60713097 frame shift probably null
Z1189:Llgl1 UTSW 11 60713097 frame shift probably null
Z1190:Llgl1 UTSW 11 60713097 frame shift probably null
Z1191:Llgl1 UTSW 11 60713097 frame shift probably null
Z1192:Llgl1 UTSW 11 60713097 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTCAGCCCAGATGTGGTTC -3'
(R):5'- CACTGTGTGAGCTGATAATGCTG -3'

Sequencing Primer
(F):5'- GAGGACCCTCCCATTTCTGG -3'
(R):5'- GAGCTGATAATGCTGCTGCCATC -3'
Posted On 2015-09-25