Incidental Mutation 'R4594:Zmynd15'
ID 344270
Institutional Source Beutler Lab
Gene Symbol Zmynd15
Ensembl Gene ENSMUSG00000040829
Gene Name zinc finger, MYND-type containing 15
Synonyms
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R4594 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 70459433-70466202 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70464182 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 335 (L335P)
Ref Sequence ENSEMBL: ENSMUSP00000104203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019064] [ENSMUST00000039093] [ENSMUST00000092958] [ENSMUST00000108563] [ENSMUST00000126105] [ENSMUST00000126391] [ENSMUST00000147289]
AlphaFold Q8C0R7
Predicted Effect probably benign
Transcript: ENSMUST00000019064
SMART Domains Protein: ENSMUSP00000019064
Gene: ENSMUSG00000018920

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:SCY 32 94 1e-17 BLAST
transmembrane domain 201 223 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039093
AA Change: L465P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048816
Gene: ENSMUSG00000040829
AA Change: L465P

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 307 353 6.7e-12 PFAM
low complexity region 438 452 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 702 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092958
SMART Domains Protein: ENSMUSP00000090635
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 306 352 6.5e-11 PFAM
low complexity region 437 451 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 662 696 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108563
AA Change: L335P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104203
Gene: ENSMUSG00000040829
AA Change: L335P

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
Pfam:zf-MYND 177 223 2.5e-11 PFAM
low complexity region 308 322 N/A INTRINSIC
low complexity region 393 405 N/A INTRINSIC
low complexity region 572 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126105
SMART Domains Protein: ENSMUSP00000134599
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126391
SMART Domains Protein: ENSMUSP00000133513
Gene: ENSMUSG00000018920

DomainStartEndE-ValueType
Blast:SCY 19 81 3e-18 BLAST
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136029
Predicted Effect probably benign
Transcript: ENSMUST00000147289
SMART Domains Protein: ENSMUSP00000136813
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154475
Meta Mutation Damage Score 0.6274 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a MYND-containing zinc-binding protein with a nuclear localization sequence. A similar gene in mice has been shown to act as a testis-specific transcriptional repressor by recruiting histone deacetylase enzymes to regulate spatiotemporal expression of many haploid genes. This protein may play an important role in spermatogenesis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele of Cxcl16 and Zmynd15 exhibit abnormal spermiogenesis and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tmem132e T C 11: 82,435,068 I206T possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Other mutations in Zmynd15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Zmynd15 APN 11 70465916 missense probably damaging 1.00
IGL01351:Zmynd15 APN 11 70463590 missense probably benign 0.28
R0086:Zmynd15 UTSW 11 70464232 missense probably damaging 1.00
R0196:Zmynd15 UTSW 11 70464226 missense probably damaging 1.00
R0667:Zmynd15 UTSW 11 70465118 missense probably damaging 1.00
R1511:Zmynd15 UTSW 11 70464793 missense probably damaging 0.98
R1660:Zmynd15 UTSW 11 70463502 missense probably damaging 1.00
R1750:Zmynd15 UTSW 11 70462567 missense probably benign 0.00
R4344:Zmynd15 UTSW 11 70461068 nonsense probably null
R4668:Zmynd15 UTSW 11 70462588 missense probably damaging 1.00
R5029:Zmynd15 UTSW 11 70462561 missense probably damaging 1.00
R5075:Zmynd15 UTSW 11 70462120 missense probably damaging 1.00
R5289:Zmynd15 UTSW 11 70466004 missense unknown
R5468:Zmynd15 UTSW 11 70461820 missense probably damaging 1.00
R6350:Zmynd15 UTSW 11 70464431 missense probably damaging 1.00
R6665:Zmynd15 UTSW 11 70464810 missense probably benign 0.01
R7078:Zmynd15 UTSW 11 70460755 missense probably damaging 1.00
R7426:Zmynd15 UTSW 11 70462188 missense probably benign 0.06
R7475:Zmynd15 UTSW 11 70461041 missense probably benign
R7673:Zmynd15 UTSW 11 70466040 missense unknown
R8003:Zmynd15 UTSW 11 70460941 missense probably benign 0.00
R8079:Zmynd15 UTSW 11 70459452 unclassified probably benign
R8536:Zmynd15 UTSW 11 70462561 missense probably damaging 1.00
R8828:Zmynd15 UTSW 11 70464191 missense probably damaging 1.00
R8972:Zmynd15 UTSW 11 70464239 missense possibly damaging 0.73
Z1088:Zmynd15 UTSW 11 70461135 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCCTGAAAGAACTGGGAGCTAG -3'
(R):5'- ATCGAATTCCTTGCCAGCC -3'

Sequencing Primer
(F):5'- GCTAGGACAGAGATCCTGATG -3'
(R):5'- ACCACGTGGATCTTCAGGGATTG -3'
Posted On 2015-09-25