Incidental Mutation 'R4594:Tmem132e'
ID 344274
Institutional Source Beutler Lab
Gene Symbol Tmem132e
Ensembl Gene ENSMUSG00000020701
Gene Name transmembrane protein 132E
Synonyms LOC270893
MMRRC Submission 041810-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock # R4594 (G1)
Quality Score 223
Status Validated
Chromosome 11
Chromosomal Location 82388900-82446332 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82435068 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 206 (I206T)
Ref Sequence ENSEMBL: ENSMUSP00000090528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054245] [ENSMUST00000092852]
AlphaFold Q6IEE6
Predicted Effect probably benign
Transcript: ENSMUST00000054245
AA Change: I298T

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052484
Gene: ENSMUSG00000020701
AA Change: I298T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:TMEM132D_N 45 176 1.1e-52 PFAM
low complexity region 202 216 N/A INTRINSIC
low complexity region 241 262 N/A INTRINSIC
low complexity region 318 328 N/A INTRINSIC
Pfam:TMEM132 451 797 1.7e-136 PFAM
low complexity region 827 837 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
Pfam:TMEM132D_C 867 944 2e-34 PFAM
low complexity region 967 998 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1036 1043 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092852
AA Change: I206T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090528
Gene: ENSMUSG00000020701
AA Change: I206T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 226 236 N/A INTRINSIC
low complexity region 471 489 N/A INTRINSIC
low complexity region 735 745 N/A INTRINSIC
low complexity region 749 762 N/A INTRINSIC
transmembrane domain 798 820 N/A INTRINSIC
low complexity region 875 906 N/A INTRINSIC
low complexity region 924 935 N/A INTRINSIC
low complexity region 944 951 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202598
Meta Mutation Damage Score 0.0998 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A G 5: 3,575,754 T64A probably damaging Het
4933427I04Rik A T 4: 123,860,538 T82S possibly damaging Het
Adamts15 A T 9: 30,921,447 I264N probably damaging Het
Alpk1 G A 3: 127,683,554 A285V probably damaging Het
Auh T C 13: 52,912,966 probably benign Het
BC030499 T A 11: 78,291,647 V94D possibly damaging Het
Cacna2d3 A G 14: 28,982,346 F826S probably benign Het
Ccdc54 G T 16: 50,590,017 Y295* probably null Het
Ctnna3 G A 10: 64,586,079 V551I probably benign Het
Diaph3 C T 14: 86,986,037 C347Y probably damaging Het
Dnajb5 A G 4: 42,950,842 probably benign Het
Dscam A T 16: 96,717,996 I847K possibly damaging Het
Fam8a1 T C 13: 46,671,266 F243S probably damaging Het
Fat2 T C 11: 55,284,752 I1712V possibly damaging Het
Fgfr1 T C 8: 25,573,836 V793A probably damaging Het
Got2 T C 8: 95,872,186 E196G probably benign Het
Gsk3b G A 16: 38,170,701 C107Y possibly damaging Het
H2-M5 T C 17: 36,987,805 T250A possibly damaging Het
Il17f T A 1: 20,777,802 T151S probably damaging Het
Ints12 A G 3: 133,108,868 N279D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kynu T A 2: 43,679,890 S395T probably benign Het
Llgl1 C T 11: 60,706,321 T226I probably benign Het
Mael T A 1: 166,235,487 Q132L probably damaging Het
Mcpt1 A T 14: 56,018,652 R49S probably benign Het
Meioc G T 11: 102,674,166 G203C probably damaging Het
Mfsd4b1 A G 10: 40,007,317 S46P probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Mx2 C A 16: 97,547,432 Y268* probably null Het
Myom1 A G 17: 71,100,074 D1064G possibly damaging Het
Nek11 A G 9: 105,392,847 probably null Het
Nfe2 A G 15: 103,248,805 L253S probably damaging Het
Nup205 T C 6: 35,196,489 I478T probably benign Het
Nxpe2 T C 9: 48,319,482 D529G probably damaging Het
Oard1 T C 17: 48,415,239 S88P possibly damaging Het
Olfr1370 C T 13: 21,072,522 V260I probably benign Het
Olfr231 G T 1: 174,117,320 T232N probably damaging Het
Olfr639 T C 7: 104,012,417 D95G probably benign Het
Olfr678 T C 7: 105,069,590 V41A probably benign Het
Olfr732 G A 14: 50,281,683 T190I probably benign Het
Olfr741 A G 14: 50,486,162 R235G probably benign Het
Olfr906 A C 9: 38,488,761 H244P probably damaging Het
Osgin1 C T 8: 119,445,253 T262I possibly damaging Het
Plcb4 A T 2: 136,002,599 M146L probably damaging Het
Prkdc A T 16: 15,767,966 E2456V possibly damaging Het
Ptk2 G A 15: 73,206,196 A1004V probably damaging Het
Rab15 G A 12: 76,800,671 probably benign Het
Rad51ap2 T C 12: 11,457,880 V601A probably benign Het
Rasef T A 4: 73,780,389 I12F possibly damaging Het
Rdh14 T A 12: 10,394,567 N139K probably damaging Het
Rexo2 A T 9: 48,480,417 V46E probably damaging Het
Slmap A T 14: 26,465,617 L68H probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Trappc8 A T 18: 20,836,948 V995E probably benign Het
Vmn2r12 A C 5: 109,086,435 I637S probably damaging Het
Vmn2r124 T C 17: 18,073,969 F773L probably damaging Het
Vmn2r99 A T 17: 19,393,662 D548V probably damaging Het
Wdr81 T C 11: 75,445,794 N1590D probably benign Het
Zbtb6 A T 2: 37,429,042 N291K possibly damaging Het
Zfp119a G A 17: 55,866,325 R173C probably benign Het
Zmynd15 T C 11: 70,464,182 L335P probably damaging Het
Other mutations in Tmem132e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Tmem132e APN 11 82438374 missense probably damaging 1.00
IGL01586:Tmem132e APN 11 82434669 missense probably damaging 1.00
IGL01729:Tmem132e APN 11 82435116 missense possibly damaging 0.89
IGL02592:Tmem132e APN 11 82434636 missense probably damaging 1.00
R0029:Tmem132e UTSW 11 82444761 missense probably damaging 1.00
R0501:Tmem132e UTSW 11 82435068 missense possibly damaging 0.90
R0612:Tmem132e UTSW 11 82443372 missense probably damaging 1.00
R0613:Tmem132e UTSW 11 82438338 missense probably damaging 1.00
R1311:Tmem132e UTSW 11 82444296 missense probably damaging 1.00
R1430:Tmem132e UTSW 11 82438296 missense probably damaging 1.00
R1607:Tmem132e UTSW 11 82437370 missense probably benign 0.39
R1710:Tmem132e UTSW 11 82443517 missense probably damaging 1.00
R1913:Tmem132e UTSW 11 82443417 missense probably damaging 1.00
R1951:Tmem132e UTSW 11 82445082 missense possibly damaging 0.84
R2018:Tmem132e UTSW 11 82445163 missense probably benign 0.26
R2051:Tmem132e UTSW 11 82440438 missense probably damaging 1.00
R2076:Tmem132e UTSW 11 82435068 missense possibly damaging 0.90
R2100:Tmem132e UTSW 11 82444531 missense probably damaging 1.00
R2325:Tmem132e UTSW 11 82434515 missense probably damaging 1.00
R2924:Tmem132e UTSW 11 82444323 missense probably damaging 1.00
R3436:Tmem132e UTSW 11 82444330 missense probably damaging 1.00
R3437:Tmem132e UTSW 11 82444330 missense probably damaging 1.00
R4704:Tmem132e UTSW 11 82443531 missense probably damaging 0.97
R4754:Tmem132e UTSW 11 82444851 nonsense probably null
R4764:Tmem132e UTSW 11 82434512 missense probably damaging 0.99
R5245:Tmem132e UTSW 11 82442638 missense probably damaging 0.96
R5720:Tmem132e UTSW 11 82442450 splice site probably null
R5793:Tmem132e UTSW 11 82444858 missense probably damaging 1.00
R5984:Tmem132e UTSW 11 82445097 missense probably damaging 1.00
R6980:Tmem132e UTSW 11 82438386 critical splice donor site probably null
R7052:Tmem132e UTSW 11 82437363 missense probably damaging 0.99
R7637:Tmem132e UTSW 11 82434516 missense probably damaging 1.00
R7918:Tmem132e UTSW 11 82445290 missense probably damaging 1.00
R8262:Tmem132e UTSW 11 82434840 missense probably benign 0.33
R8772:Tmem132e UTSW 11 82434311 missense probably damaging 0.99
R9248:Tmem132e UTSW 11 82444482 missense probably damaging 1.00
Z1177:Tmem132e UTSW 11 82435178 missense probably damaging 1.00
Z1177:Tmem132e UTSW 11 82445104 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTTGAGCTCTACTATACGCTGCAC -3'
(R):5'- TTGTGAGATGACCCTGGAGG -3'

Sequencing Primer
(F):5'- TACTATACGCTGCACGCCCCCGATG -3'
(R):5'- ATGAGGATGCTGAGGTCCCAC -3'
Posted On 2015-09-25