Incidental Mutation 'R0064:Nlrc3'
ID34428
Institutional Source Beutler Lab
Gene Symbol Nlrc3
Ensembl Gene ENSMUSG00000049871
Gene NameNLR family, CARD domain containing 3
SynonymsCLR16.2, Caterpiller 16.2, D230007K08Rik
MMRRC Submission 038356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0064 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3945007-3976632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3964087 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 486 (T486K)
Ref Sequence ENSEMBL: ENSMUSP00000155241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177551] [ENSMUST00000180200] [ENSMUST00000229884]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163478
Predicted Effect possibly damaging
Transcript: ENSMUST00000177551
AA Change: T502K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871
AA Change: T502K

DomainStartEndE-ValueType
Pfam:NACHT 176 342 2e-34 PFAM
LRR 702 729 3.11e-2 SMART
LRR 730 757 2.27e-4 SMART
LRR 758 785 8.15e-1 SMART
LRR 786 813 2.17e-1 SMART
LRR 814 841 2.12e-4 SMART
LRR 842 869 3.42e0 SMART
LRR 870 897 7.67e-2 SMART
LRR 898 925 3.21e0 SMART
LRR 926 953 1.67e0 SMART
LRR 954 981 4.87e-4 SMART
LRR 982 1009 4.3e0 SMART
LRR 1010 1037 3.8e-6 SMART
LRR 1038 1065 4.47e-3 SMART
LRR 1066 1093 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180200
SMART Domains Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
LRR 4 24 8.65e1 SMART
LRR 25 52 2.27e-4 SMART
LRR 53 80 8.15e-1 SMART
LRR 81 108 2.17e-1 SMART
LRR 109 136 2.12e-4 SMART
LRR 137 164 3.42e0 SMART
LRR 165 192 7.67e-2 SMART
LRR 193 220 3.21e0 SMART
LRR 221 248 1.67e0 SMART
LRR 249 276 4.87e-4 SMART
LRR 277 304 4.3e0 SMART
LRR 305 332 3.8e-6 SMART
LRR 333 360 4.47e-3 SMART
LRR 361 388 1.08e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000229884
AA Change: T486K

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a NOD-like receptor family member. The encoded protein is a cytosolic regulator of innate immunity. This protein directly interacts with stimulator of interferon genes (STING), to prevent its proper trafficking, resulting in disruption of STING-dependent activation of the innate immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced susceptibility to LPS-induced toxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A C 11: 110,144,871 L641R probably damaging Het
Abca9 G T 11: 110,144,872 L641M probably damaging Het
Abhd18 A G 3: 40,933,853 I377M probably benign Het
Arhgef17 C A 7: 100,881,354 M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 G138A probably damaging Het
C4b A G 17: 34,738,856 L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 D101G probably benign Het
Cdon A G 9: 35,489,227 H1079R probably benign Het
Cep126 A T 9: 8,130,182 probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Crlf3 A G 11: 80,057,902 I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 N78K probably damaging Het
Cul1 A G 6: 47,502,415 probably benign Het
D430041D05Rik T G 2: 104,249,157 T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 Y16* probably null Het
Fgd3 T G 13: 49,296,425 D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 T496I probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Klhl5 T A 5: 65,141,288 S137T probably benign Het
Knl1 T A 2: 119,076,243 N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 N463K probably damaging Het
Lpl A G 8: 68,892,704 H120R probably damaging Het
Man1a2 A T 3: 100,591,883 S412T possibly damaging Het
Mcc C G 18: 44,519,516 probably benign Het
Myo18a G T 11: 77,847,344 R1704L probably damaging Het
Nrip1 T A 16: 76,294,670 probably benign Het
Nutf2 A G 8: 105,878,809 D92G probably damaging Het
Obscn A C 11: 59,027,466 V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 V201M probably benign Het
Olfr714 T C 7: 107,074,280 F151L probably benign Het
Plce1 T C 19: 38,780,784 probably null Het
Pmpca C A 2: 26,395,507 D498E probably benign Het
Pnpla7 G T 2: 24,997,227 E28* probably null Het
Polg C A 7: 79,461,884 W206C probably damaging Het
Ptprt C T 2: 161,927,791 probably benign Het
Slc7a14 T C 3: 31,227,060 D367G probably damaging Het
Spata31 T C 13: 64,922,098 Y687H probably damaging Het
Sybu T A 15: 44,672,993 T646S probably benign Het
Thbs1 A T 2: 118,123,914 probably null Het
Tie1 A G 4: 118,489,701 V2A possibly damaging Het
Tma16 A T 8: 66,476,805 I179K possibly damaging Het
Tns3 G A 11: 8,435,856 Q1381* probably null Het
Trank1 A G 9: 111,343,195 D84G probably damaging Het
Ttc3 A T 16: 94,422,247 H197L possibly damaging Het
Urb1 A G 16: 90,779,140 F843L probably benign Het
Vmn1r24 T G 6: 57,956,018 I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 I82L probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 I684N probably benign Het
Other mutations in Nlrc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nlrc3 APN 16 3955166 missense probably damaging 1.00
IGL00943:Nlrc3 APN 16 3965117 missense possibly damaging 0.94
IGL01481:Nlrc3 APN 16 3963905 missense probably damaging 1.00
IGL01517:Nlrc3 APN 16 3947487 missense probably damaging 0.99
IGL01988:Nlrc3 APN 16 3953939 missense probably benign 0.43
IGL02306:Nlrc3 APN 16 3964824 missense probably damaging 1.00
IGL02515:Nlrc3 APN 16 3949459 splice site probably benign
IGL02795:Nlrc3 APN 16 3965285 missense probably damaging 0.99
IGL02897:Nlrc3 APN 16 3964074 missense possibly damaging 0.85
IGL02992:Nlrc3 APN 16 3954023 splice site probably benign
IGL03003:Nlrc3 APN 16 3964862 missense probably benign 0.03
IGL03381:Nlrc3 APN 16 3964315 missense probably benign 0.03
R0064:Nlrc3 UTSW 16 3964087 missense possibly damaging 0.82
R0122:Nlrc3 UTSW 16 3958958 missense probably damaging 0.98
R0482:Nlrc3 UTSW 16 3965192 missense possibly damaging 0.81
R0601:Nlrc3 UTSW 16 3948249 splice site probably benign
R0622:Nlrc3 UTSW 16 3953968 missense probably benign 0.04
R0675:Nlrc3 UTSW 16 3948911 missense probably benign 0.01
R1595:Nlrc3 UTSW 16 3965302 missense probably benign 0.03
R1597:Nlrc3 UTSW 16 3963995 missense probably damaging 1.00
R2013:Nlrc3 UTSW 16 3965110 missense probably damaging 1.00
R2077:Nlrc3 UTSW 16 3963992 missense probably benign 0.35
R2327:Nlrc3 UTSW 16 3953440 missense probably damaging 1.00
R2872:Nlrc3 UTSW 16 3957326 missense possibly damaging 0.56
R2872:Nlrc3 UTSW 16 3957326 missense possibly damaging 0.56
R3037:Nlrc3 UTSW 16 3952408 missense probably damaging 1.00
R3794:Nlrc3 UTSW 16 3947875 missense probably benign 0.22
R3843:Nlrc3 UTSW 16 3964964 missense probably benign
R4761:Nlrc3 UTSW 16 3963650 missense probably damaging 1.00
R5303:Nlrc3 UTSW 16 3963614 missense probably benign 0.15
R5375:Nlrc3 UTSW 16 3964753 missense possibly damaging 0.95
R5468:Nlrc3 UTSW 16 3964035 missense probably damaging 1.00
R5719:Nlrc3 UTSW 16 3963725 missense probably damaging 1.00
R5838:Nlrc3 UTSW 16 3953995 missense probably damaging 1.00
R5879:Nlrc3 UTSW 16 3964045 missense probably damaging 1.00
R5942:Nlrc3 UTSW 16 3949429 missense probably damaging 1.00
R6500:Nlrc3 UTSW 16 3952444 missense possibly damaging 0.79
R6600:Nlrc3 UTSW 16 3965074 missense probably benign 0.29
R6704:Nlrc3 UTSW 16 3965081 missense probably damaging 0.99
R7172:Nlrc3 UTSW 16 3963753 missense probably benign 0.30
R7283:Nlrc3 UTSW 16 3947877 missense probably benign 0.25
R7296:Nlrc3 UTSW 16 3963590 missense probably damaging 0.99
R7477:Nlrc3 UTSW 16 3964811 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAGGAAGCCTTGTAGGACCTCAG -3'
(R):5'- ATAGAGCTGCCATTGCCTCAGACC -3'

Sequencing Primer
(F):5'- CCAGCAGAGTATTGACCCTTG -3'
(R):5'- CTAGGATCAAGCAGGTGACCC -3'
Posted On2013-05-09