Mutagenetix > Incidental Mutations

Incidental Mutation 'R0064:Nlrc3'

34428

Institutional Source

Beutler Lab

Gene Symbol

Nlrc3

Ensembl Gene

ENSMUSG00000049871

Gene Name

NLR family, CARD domain containing 3

Synonyms

CLR16.2, Caterpiller 16.2, D230007K08Rik

MMRRC Submission

038356-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R0064 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3945007-3976632 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 3964087 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 486 (T486K)

Ref Sequence

ENSEMBL: ENSMUSP00000155241 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000177551] [ENSMUST00000180200] [ENSMUST00000229884]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000096308

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163478

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177551
AA Change: T502K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871
AA Change: T502K

Domain	Start	End	E-Value	Type
Pfam:NACHT	176	342	2e-34	PFAM
LRR	702	729	3.11e-2	SMART
LRR	730	757	2.27e-4	SMART
LRR	758	785	8.15e-1	SMART
LRR	786	813	2.17e-1	SMART
LRR	814	841	2.12e-4	SMART
LRR	842	869	3.42e0	SMART
LRR	870	897	7.67e-2	SMART
LRR	898	925	3.21e0	SMART
LRR	926	953	1.67e0	SMART
LRR	954	981	4.87e-4	SMART
LRR	982	1009	4.3e0	SMART
LRR	1010	1037	3.8e-6	SMART
LRR	1038	1065	4.47e-3	SMART
LRR	1066	1093	1.08e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000180200

SMART Domains

Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871

Domain	Start	End	E-Value	Type
LRR	4	24	8.65e1	SMART
LRR	25	52	2.27e-4	SMART
LRR	53	80	8.15e-1	SMART
LRR	81	108	2.17e-1	SMART
LRR	109	136	2.12e-4	SMART
LRR	137	164	3.42e0	SMART
LRR	165	192	7.67e-2	SMART
LRR	193	220	3.21e0	SMART
LRR	221	248	1.67e0	SMART
LRR	249	276	4.87e-4	SMART
LRR	277	304	4.3e0	SMART
LRR	305	332	3.8e-6	SMART
LRR	333	360	4.47e-3	SMART
LRR	361	388	1.08e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229884
AA Change: T486K

PolyPhen 2 Score 0.823 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a NOD-like receptor family member. The encoded protein is a cytosolic regulator of innate immunity. This protein directly interacts with stimulator of interferon genes (STING), to prevent its proper trafficking, resulting in disruption of STING-dependent activation of the innate immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced susceptibility to LPS-induced toxic shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	C	11: 110,144,871	L641R	probably damaging	Het
Abca9	G	T	11: 110,144,872	L641M	probably damaging	Het
Abhd18	A	G	3: 40,933,853	I377M	probably benign	Het
Arhgef17	C	A	7: 100,881,354	M1408I	probably benign	Het
Bcl2a1a	G	C	9: 88,957,463	G138A	probably damaging	Het
C4b	A	G	17: 34,738,856	L617P	probably damaging	Het
Ccdc25	T	A	14: 65,854,112	I60K	possibly damaging	Het
Cdk1	T	C	10: 69,345,077	D101G	probably benign	Het
Cdon	A	G	9: 35,489,227	H1079R	probably benign	Het
Cep126	A	T	9: 8,130,182		probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Crlf3	A	G	11: 80,057,902	I239T	possibly damaging	Het
Cstf2t	T	A	19: 31,083,299	N78K	probably damaging	Het
Cul1	A	G	6: 47,502,415		probably benign	Het
D430041D05Rik	T	G	2: 104,249,157	T1194P	probably damaging	Het
Fbp2	A	T	13: 62,854,048	F118I	probably damaging	Het
Fbxw14	A	T	9: 109,287,592	Y16*	probably null	Het
Fgd3	T	G	13: 49,296,425	D116A	possibly damaging	Het
Gm7168	C	T	17: 13,949,859	T496I	probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Klhl5	T	A	5: 65,141,288	S137T	probably benign	Het
Knl1	T	A	2: 119,076,243	N1604K	probably benign	Het
Lpcat1	T	A	13: 73,514,466	N463K	probably damaging	Het
Lpl	A	G	8: 68,892,704	H120R	probably damaging	Het
Man1a2	A	T	3: 100,591,883	S412T	possibly damaging	Het
Mcc	C	G	18: 44,519,516		probably benign	Het
Myo18a	G	T	11: 77,847,344	R1704L	probably damaging	Het
Nrip1	T	A	16: 76,294,670		probably benign	Het
Nutf2	A	G	8: 105,878,809	D92G	probably damaging	Het
Obscn	A	C	11: 59,027,466	V6260G	probably damaging	Het
Olfr320	G	A	11: 58,684,475	V201M	probably benign	Het
Olfr714	T	C	7: 107,074,280	F151L	probably benign	Het
Plce1	T	C	19: 38,780,784		probably null	Het
Pmpca	C	A	2: 26,395,507	D498E	probably benign	Het
Pnpla7	G	T	2: 24,997,227	E28*	probably null	Het
Polg	C	A	7: 79,461,884	W206C	probably damaging	Het
Ptprt	C	T	2: 161,927,791		probably benign	Het
Slc7a14	T	C	3: 31,227,060	D367G	probably damaging	Het
Spata31	T	C	13: 64,922,098	Y687H	probably damaging	Het
Sybu	T	A	15: 44,672,993	T646S	probably benign	Het
Thbs1	A	T	2: 118,123,914		probably null	Het
Tie1	A	G	4: 118,489,701	V2A	possibly damaging	Het
Tma16	A	T	8: 66,476,805	I179K	possibly damaging	Het
Tns3	G	A	11: 8,435,856	Q1381*	probably null	Het
Trank1	A	G	9: 111,343,195	D84G	probably damaging	Het
Ttc3	A	T	16: 94,422,247	H197L	possibly damaging	Het
Urb1	A	G	16: 90,779,140	F843L	probably benign	Het
Vmn1r24	T	G	6: 57,956,018	I172L	probably benign	Het
Vmn2r1	T	A	3: 64,104,788	I690N	possibly damaging	Het
Vmn2r111	T	A	17: 22,572,072	I82L	probably benign	Het
Zfp287	A	T	11: 62,714,938	L370H	possibly damaging	Het
Zfp608	A	T	18: 54,898,816	I684N	probably benign	Het

Other mutations in Nlrc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Nlrc3	APN	16	3955166	missense	probably damaging	1.00
IGL00943:Nlrc3	APN	16	3965117	missense	possibly damaging	0.94
IGL01481:Nlrc3	APN	16	3963905	missense	probably damaging	1.00
IGL01517:Nlrc3	APN	16	3947487	missense	probably damaging	0.99
IGL01988:Nlrc3	APN	16	3953939	missense	probably benign	0.43
IGL02306:Nlrc3	APN	16	3964824	missense	probably damaging	1.00
IGL02515:Nlrc3	APN	16	3949459	splice site	probably benign
IGL02795:Nlrc3	APN	16	3965285	missense	probably damaging	0.99
IGL02897:Nlrc3	APN	16	3964074	missense	possibly damaging	0.85
IGL02992:Nlrc3	APN	16	3954023	splice site	probably benign
IGL03003:Nlrc3	APN	16	3964862	missense	probably benign	0.03
IGL03381:Nlrc3	APN	16	3964315	missense	probably benign	0.03
R0064:Nlrc3	UTSW	16	3964087	missense	possibly damaging	0.82
R0122:Nlrc3	UTSW	16	3958958	missense	probably damaging	0.98
R0482:Nlrc3	UTSW	16	3965192	missense	possibly damaging	0.81
R0601:Nlrc3	UTSW	16	3948249	splice site	probably benign
R0622:Nlrc3	UTSW	16	3953968	missense	probably benign	0.04
R0675:Nlrc3	UTSW	16	3948911	missense	probably benign	0.01
R1595:Nlrc3	UTSW	16	3965302	missense	probably benign	0.03
R1597:Nlrc3	UTSW	16	3963995	missense	probably damaging	1.00
R2013:Nlrc3	UTSW	16	3965110	missense	probably damaging	1.00
R2077:Nlrc3	UTSW	16	3963992	missense	probably benign	0.35
R2327:Nlrc3	UTSW	16	3953440	missense	probably damaging	1.00
R2872:Nlrc3	UTSW	16	3957326	missense	possibly damaging	0.56
R2872:Nlrc3	UTSW	16	3957326	missense	possibly damaging	0.56
R3037:Nlrc3	UTSW	16	3952408	missense	probably damaging	1.00
R3794:Nlrc3	UTSW	16	3947875	missense	probably benign	0.22
R3843:Nlrc3	UTSW	16	3964964	missense	probably benign
R4761:Nlrc3	UTSW	16	3963650	missense	probably damaging	1.00
R5303:Nlrc3	UTSW	16	3963614	missense	probably benign	0.15
R5375:Nlrc3	UTSW	16	3964753	missense	possibly damaging	0.95
R5468:Nlrc3	UTSW	16	3964035	missense	probably damaging	1.00
R5719:Nlrc3	UTSW	16	3963725	missense	probably damaging	1.00
R5838:Nlrc3	UTSW	16	3953995	missense	probably damaging	1.00
R5879:Nlrc3	UTSW	16	3964045	missense	probably damaging	1.00
R5942:Nlrc3	UTSW	16	3949429	missense	probably damaging	1.00
R6500:Nlrc3	UTSW	16	3952444	missense	possibly damaging	0.79
R6600:Nlrc3	UTSW	16	3965074	missense	probably benign	0.29
R6704:Nlrc3	UTSW	16	3965081	missense	probably damaging	0.99
R7172:Nlrc3	UTSW	16	3963753	missense	probably benign	0.30
R7283:Nlrc3	UTSW	16	3947877	missense	probably benign	0.25
R7296:Nlrc3	UTSW	16	3963590	missense	probably damaging	0.99
R7477:Nlrc3	UTSW	16	3964811	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGAAGGAAGCCTTGTAGGACCTCAG -3'
(R):5'- ATAGAGCTGCCATTGCCTCAGACC -3'

Sequencing Primer
(F):5'- CCAGCAGAGTATTGACCCTTG -3'
(R):5'- CTAGGATCAAGCAGGTGACCC -3'

Posted On

2013-05-09