Mutagenetix > Incidental Mutations

Incidental Mutation 'R4594:Slmap'

344282

Institutional Source

Beutler Lab

Gene Symbol

Slmap

Ensembl Gene

ENSMUSG00000021870

Gene Name

sarcolemma associated protein

Synonyms

D330001L02Rik, Slap

MMRRC Submission

041810-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4594 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26413168-26534931 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26465617 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 68 (L68H)

Ref Sequence

ENSEMBL: ENSMUSP00000107950 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038522] [ENSMUST00000090359] [ENSMUST00000102956] [ENSMUST00000112330] [ENSMUST00000112331] [ENSMUST00000139075]

AlphaFold

Q3URD3

Predicted Effect

probably damaging
Transcript: ENSMUST00000038522
AA Change: L189H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000046956
Gene: ENSMUSG00000021870
AA Change: L189H

Domain	Start	End	E-Value	Type
FHA	27	85	1.05e-8	SMART
coiled coil region	167	199	N/A	INTRINSIC
coiled coil region	230	390	N/A	INTRINSIC
coiled coil region	486	568	N/A	INTRINSIC
coiled coil region	595	794	N/A	INTRINSIC
transmembrane domain	796	818	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090359
AA Change: L189H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087836
Gene: ENSMUSG00000021870
AA Change: L189H

Domain	Start	End	E-Value	Type
FHA	27	85	1.05e-8	SMART
coiled coil region	167	199	N/A	INTRINSIC
coiled coil region	230	390	N/A	INTRINSIC
coiled coil region	490	572	N/A	INTRINSIC
coiled coil region	599	799	N/A	INTRINSIC
transmembrane domain	801	823	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102956
AA Change: L189H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000100021
Gene: ENSMUSG00000021870
AA Change: L189H

Domain	Start	End	E-Value	Type
FHA	27	85	1.05e-8	SMART
coiled coil region	167	199	N/A	INTRINSIC
coiled coil region	230	390	N/A	INTRINSIC
coiled coil region	486	568	N/A	INTRINSIC
coiled coil region	595	794	N/A	INTRINSIC
transmembrane domain	796	818	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112330
AA Change: L189H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107949
Gene: ENSMUSG00000021870
AA Change: L189H

Domain	Start	End	E-Value	Type
FHA	27	85	1.05e-8	SMART
coiled coil region	167	199	N/A	INTRINSIC
coiled coil region	230	383	N/A	INTRINSIC
coiled coil region	452	534	N/A	INTRINSIC
coiled coil region	561	761	N/A	INTRINSIC
transmembrane domain	763	785	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112331
AA Change: L68H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107950
Gene: ENSMUSG00000021870
AA Change: L68H

Domain	Start	End	E-Value	Type
coiled coil region	46	78	N/A	INTRINSIC
coiled coil region	109	260	N/A	INTRINSIC
coiled coil region	352	434	N/A	INTRINSIC
coiled coil region	461	661	N/A	INTRINSIC
transmembrane domain	663	685	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000139075
AA Change: L189H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117816
Gene: ENSMUSG00000021870
AA Change: L189H

Domain	Start	End	E-Value	Type
FHA	27	85	1.05e-8	SMART
coiled coil region	167	199	N/A	INTRINSIC
coiled coil region	230	390	N/A	INTRINSIC
coiled coil region	507	589	N/A	INTRINSIC
coiled coil region	616	816	N/A	INTRINSIC
transmembrane domain	818	840	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144737

Predicted Effect

probably benign
Transcript: ENSMUST00000146438

SMART Domains

Protein: ENSMUSP00000123344
Gene: ENSMUSG00000021870

Domain	Start	End	E-Value	Type
coiled coil region	17	142	N/A	INTRINSIC

Meta Mutation Damage Score

0.6312

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a conserved striatin-interacting phosphatase and kinase complex. Striatin family complexes participate in a variety of cellular processes including signaling, cell cycle control, cell migration, Golgi assembly, and apoptosis. The protein encoded by this gene is a coiled-coil, tail-anchored membrane protein with a single C-terminal transmembrane domain that is posttranslationally inserted into membranes. Mutations in this gene are associated with Brugada syndrome, a cardiac channelopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous inactivation in this locus affects T cell development. Mice homozygous for a transposon induced allele exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,575,754	T64A	probably damaging	Het
4933427I04Rik	A	T	4: 123,860,538	T82S	possibly damaging	Het
Adamts15	A	T	9: 30,921,447	I264N	probably damaging	Het
Alpk1	G	A	3: 127,683,554	A285V	probably damaging	Het
Auh	T	C	13: 52,912,966		probably benign	Het
BC030499	T	A	11: 78,291,647	V94D	possibly damaging	Het
Cacna2d3	A	G	14: 28,982,346	F826S	probably benign	Het
Ccdc54	G	T	16: 50,590,017	Y295*	probably null	Het
Ctnna3	G	A	10: 64,586,079	V551I	probably benign	Het
Diaph3	C	T	14: 86,986,037	C347Y	probably damaging	Het
Dnajb5	A	G	4: 42,950,842		probably benign	Het
Dscam	A	T	16: 96,717,996	I847K	possibly damaging	Het
Fam8a1	T	C	13: 46,671,266	F243S	probably damaging	Het
Fat2	T	C	11: 55,284,752	I1712V	possibly damaging	Het
Fgfr1	T	C	8: 25,573,836	V793A	probably damaging	Het
Got2	T	C	8: 95,872,186	E196G	probably benign	Het
Gsk3b	G	A	16: 38,170,701	C107Y	possibly damaging	Het
H2-M5	T	C	17: 36,987,805	T250A	possibly damaging	Het
Il17f	T	A	1: 20,777,802	T151S	probably damaging	Het
Ints12	A	G	3: 133,108,868	N279D	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kynu	T	A	2: 43,679,890	S395T	probably benign	Het
Llgl1	C	T	11: 60,706,321	T226I	probably benign	Het
Mael	T	A	1: 166,235,487	Q132L	probably damaging	Het
Mcpt1	A	T	14: 56,018,652	R49S	probably benign	Het
Meioc	G	T	11: 102,674,166	G203C	probably damaging	Het
Mfsd4b1	A	G	10: 40,007,317	S46P	probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mx2	C	A	16: 97,547,432	Y268*	probably null	Het
Myom1	A	G	17: 71,100,074	D1064G	possibly damaging	Het
Nek11	A	G	9: 105,392,847		probably null	Het
Nfe2	A	G	15: 103,248,805	L253S	probably damaging	Het
Nup205	T	C	6: 35,196,489	I478T	probably benign	Het
Nxpe2	T	C	9: 48,319,482	D529G	probably damaging	Het
Oard1	T	C	17: 48,415,239	S88P	possibly damaging	Het
Olfr1370	C	T	13: 21,072,522	V260I	probably benign	Het
Olfr231	G	T	1: 174,117,320	T232N	probably damaging	Het
Olfr639	T	C	7: 104,012,417	D95G	probably benign	Het
Olfr678	T	C	7: 105,069,590	V41A	probably benign	Het
Olfr732	G	A	14: 50,281,683	T190I	probably benign	Het
Olfr741	A	G	14: 50,486,162	R235G	probably benign	Het
Olfr906	A	C	9: 38,488,761	H244P	probably damaging	Het
Osgin1	C	T	8: 119,445,253	T262I	possibly damaging	Het
Plcb4	A	T	2: 136,002,599	M146L	probably damaging	Het
Prkdc	A	T	16: 15,767,966	E2456V	possibly damaging	Het
Ptk2	G	A	15: 73,206,196	A1004V	probably damaging	Het
Rab15	G	A	12: 76,800,671		probably benign	Het
Rad51ap2	T	C	12: 11,457,880	V601A	probably benign	Het
Rasef	T	A	4: 73,780,389	I12F	possibly damaging	Het
Rdh14	T	A	12: 10,394,567	N139K	probably damaging	Het
Rexo2	A	T	9: 48,480,417	V46E	probably damaging	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Tmem132e	T	C	11: 82,435,068	I206T	possibly damaging	Het
Trappc8	A	T	18: 20,836,948	V995E	probably benign	Het
Vmn2r12	A	C	5: 109,086,435	I637S	probably damaging	Het
Vmn2r124	T	C	17: 18,073,969	F773L	probably damaging	Het
Vmn2r99	A	T	17: 19,393,662	D548V	probably damaging	Het
Wdr81	T	C	11: 75,445,794	N1590D	probably benign	Het
Zbtb6	A	T	2: 37,429,042	N291K	possibly damaging	Het
Zfp119a	G	A	17: 55,866,325	R173C	probably benign	Het
Zmynd15	T	C	11: 70,464,182	L335P	probably damaging	Het

Other mutations in Slmap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02402:Slmap	APN	14	26463710	missense	probably damaging	0.97
IGL02612:Slmap	APN	14	26459466	splice site	probably benign
IGL02630:Slmap	APN	14	26422431	missense	possibly damaging	0.93
IGL02798:Slmap	APN	14	26470378	missense	possibly damaging	0.88
PIT4382001:Slmap	UTSW	14	26533431	missense	probably damaging	1.00
R0433:Slmap	UTSW	14	26453594	nonsense	probably null
R0963:Slmap	UTSW	14	26468520	missense	probably damaging	1.00
R1721:Slmap	UTSW	14	26460218	splice site	probably benign
R1848:Slmap	UTSW	14	26422574	missense	probably benign
R2151:Slmap	UTSW	14	26418247	missense	probably damaging	1.00
R2152:Slmap	UTSW	14	26418247	missense	probably damaging	1.00
R2153:Slmap	UTSW	14	26418247	missense	probably damaging	1.00
R2154:Slmap	UTSW	14	26418247	missense	probably damaging	1.00
R3725:Slmap	UTSW	14	26427242	missense	probably damaging	0.99
R3726:Slmap	UTSW	14	26427242	missense	probably damaging	0.99
R3935:Slmap	UTSW	14	26459415	missense	probably benign
R4118:Slmap	UTSW	14	26482872	missense	probably damaging	0.99
R4731:Slmap	UTSW	14	26468535	missense	probably damaging	0.97
R4732:Slmap	UTSW	14	26468535	missense	probably damaging	0.97
R4733:Slmap	UTSW	14	26468535	missense	probably damaging	0.97
R4817:Slmap	UTSW	14	26462352	missense	probably damaging	0.97
R4847:Slmap	UTSW	14	26426608	missense	possibly damaging	0.90
R4860:Slmap	UTSW	14	26460209	missense	probably benign	0.22
R4860:Slmap	UTSW	14	26460209	missense	probably benign	0.22
R5092:Slmap	UTSW	14	26463589	missense	probably damaging	1.00
R5211:Slmap	UTSW	14	26482962	missense	probably damaging	1.00
R5387:Slmap	UTSW	14	26459933	missense	probably benign	0.22
R5821:Slmap	UTSW	14	26462280	missense	probably damaging	1.00
R6404:Slmap	UTSW	14	26422411	splice site	probably null
R6856:Slmap	UTSW	14	26430092	splice site	probably null
R6977:Slmap	UTSW	14	26533419	missense	probably damaging	1.00
R7108:Slmap	UTSW	14	26422521	missense	probably benign	0.04
R7320:Slmap	UTSW	14	26460072	missense	possibly damaging	0.53
R7470:Slmap	UTSW	14	26427420	missense	probably benign
R7520:Slmap	UTSW	14	26427420	missense	probably benign
R7540:Slmap	UTSW	14	26460191	missense	probably damaging	0.99
R7544:Slmap	UTSW	14	26429846	missense	probably damaging	0.99
R7544:Slmap	UTSW	14	26429848	missense	probably damaging	0.99
R8112:Slmap	UTSW	14	26422548	missense	probably damaging	1.00
R8153:Slmap	UTSW	14	26533333	missense	probably benign
R8196:Slmap	UTSW	14	26468491	missense	probably damaging	1.00
R8300:Slmap	UTSW	14	26418219	missense	possibly damaging	0.62
R8523:Slmap	UTSW	14	26429810	missense	probably damaging	0.99
R9039:Slmap	UTSW	14	26533364	missense	probably benign	0.08
Z1177:Slmap	UTSW	14	26533450	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGCCTGCAACTGGTTTCCC -3'
(R):5'- TGGGCTAAAGCACTGAGAC -3'

Sequencing Primer
(F):5'- CCATAACTTCTAACCGTGATAAGAG -3'
(R):5'- GGCTAAAGCACTGAGACGCATC -3'

Posted On

2015-09-25