Incidental Mutation 'R0064:Urb1'
ID 34429
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene Name URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms 4921511H13Rik, 5730405K23Rik
MMRRC Submission 038356-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0064 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 90751527-90810413 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90779140 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 843 (F843L)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000140920
AA Change: F843L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: F843L

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142955
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,144,872 (GRCm38) L641M probably damaging Het
Abca9 A C 11: 110,144,871 (GRCm38) L641R probably damaging Het
Abhd18 A G 3: 40,933,853 (GRCm38) I377M probably benign Het
Arhgef17 C A 7: 100,881,354 (GRCm38) M1408I probably benign Het
Bcl2a1a G C 9: 88,957,463 (GRCm38) G138A probably damaging Het
C4b A G 17: 34,738,856 (GRCm38) L617P probably damaging Het
Ccdc25 T A 14: 65,854,112 (GRCm38) I60K possibly damaging Het
Cdk1 T C 10: 69,345,077 (GRCm38) D101G probably benign Het
Cdon A G 9: 35,489,227 (GRCm38) H1079R probably benign Het
Cep126 A T 9: 8,130,182 (GRCm38) probably benign Het
Cic T A 7: 25,287,140 (GRCm38) S1299T probably damaging Het
Cic C A 7: 25,287,141 (GRCm38) S1299Y probably damaging Het
Clstn1 G A 4: 149,634,796 (GRCm38) V361M probably damaging Het
Crlf3 A G 11: 80,057,902 (GRCm38) I239T possibly damaging Het
Cstf2t T A 19: 31,083,299 (GRCm38) N78K probably damaging Het
Cul1 A G 6: 47,502,415 (GRCm38) probably benign Het
D430041D05Rik T G 2: 104,249,157 (GRCm38) T1194P probably damaging Het
Fbp2 A T 13: 62,854,048 (GRCm38) F118I probably damaging Het
Fbxw14 A T 9: 109,287,592 (GRCm38) Y16* probably null Het
Fgd3 T G 13: 49,296,425 (GRCm38) D116A possibly damaging Het
Gm7168 C T 17: 13,949,859 (GRCm38) T496I probably benign Het
Hsh2d G A 8: 72,200,460 (GRCm38) D229N probably benign Het
Klhl5 T A 5: 65,141,288 (GRCm38) S137T probably benign Het
Knl1 T A 2: 119,076,243 (GRCm38) N1604K probably benign Het
Lpcat1 T A 13: 73,514,466 (GRCm38) N463K probably damaging Het
Lpl A G 8: 68,892,704 (GRCm38) H120R probably damaging Het
Man1a2 A T 3: 100,591,883 (GRCm38) S412T possibly damaging Het
Mcc C G 18: 44,519,516 (GRCm38) probably benign Het
Myo18a G T 11: 77,847,344 (GRCm38) R1704L probably damaging Het
Nlrc3 G T 16: 3,964,087 (GRCm38) T486K possibly damaging Het
Nrip1 T A 16: 76,294,670 (GRCm38) probably benign Het
Nutf2 A G 8: 105,878,809 (GRCm38) D92G probably damaging Het
Obscn A C 11: 59,027,466 (GRCm38) V6260G probably damaging Het
Olfr320 G A 11: 58,684,475 (GRCm38) V201M probably benign Het
Olfr714 T C 7: 107,074,280 (GRCm38) F151L probably benign Het
Plce1 T C 19: 38,780,784 (GRCm38) probably null Het
Pmpca C A 2: 26,395,507 (GRCm38) D498E probably benign Het
Pnpla7 G T 2: 24,997,227 (GRCm38) E28* probably null Het
Polg C A 7: 79,461,884 (GRCm38) W206C probably damaging Het
Ptprt C T 2: 161,927,791 (GRCm38) probably benign Het
Slc7a14 T C 3: 31,227,060 (GRCm38) D367G probably damaging Het
Spata31 T C 13: 64,922,098 (GRCm38) Y687H probably damaging Het
Sybu T A 15: 44,672,993 (GRCm38) T646S probably benign Het
Thbs1 A T 2: 118,123,914 (GRCm38) probably null Het
Tie1 A G 4: 118,489,701 (GRCm38) V2A possibly damaging Het
Tma16 A T 8: 66,476,805 (GRCm38) I179K possibly damaging Het
Tns3 G A 11: 8,435,856 (GRCm38) Q1381* probably null Het
Trank1 A G 9: 111,343,195 (GRCm38) D84G probably damaging Het
Ttc3 A T 16: 94,422,247 (GRCm38) H197L possibly damaging Het
Vmn1r24 T G 6: 57,956,018 (GRCm38) I172L probably benign Het
Vmn2r1 T A 3: 64,104,788 (GRCm38) I690N possibly damaging Het
Vmn2r111 T A 17: 22,572,072 (GRCm38) I82L probably benign Het
Zfp287 A T 11: 62,714,938 (GRCm38) L370H possibly damaging Het
Zfp608 A T 18: 54,898,816 (GRCm38) I684N probably benign Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90,753,321 (GRCm38) critical splice donor site probably null
IGL00915:Urb1 APN 16 90,779,098 (GRCm38) missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90,792,814 (GRCm38) missense probably damaging 1.00
IGL01122:Urb1 APN 16 90,804,458 (GRCm38) missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90,757,761 (GRCm38) missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90,777,560 (GRCm38) missense probably benign 0.11
IGL01606:Urb1 APN 16 90,760,459 (GRCm38) missense probably damaging 1.00
IGL01989:Urb1 APN 16 90,769,586 (GRCm38) splice site probably benign
IGL02516:Urb1 APN 16 90,772,695 (GRCm38) missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90,788,156 (GRCm38) missense probably benign 0.02
IGL03165:Urb1 APN 16 90,780,304 (GRCm38) missense probably damaging 1.00
IGL03216:Urb1 APN 16 90,788,114 (GRCm38) missense probably benign 0.00
H8562:Urb1 UTSW 16 90,769,469 (GRCm38) missense probably benign 0.08
H8786:Urb1 UTSW 16 90,769,469 (GRCm38) missense probably benign 0.08
R0064:Urb1 UTSW 16 90,779,140 (GRCm38) missense probably benign
R0359:Urb1 UTSW 16 90,791,160 (GRCm38) missense probably damaging 1.00
R0386:Urb1 UTSW 16 90,796,399 (GRCm38) missense probably damaging 1.00
R0508:Urb1 UTSW 16 90,783,262 (GRCm38) splice site probably benign
R0517:Urb1 UTSW 16 90,777,422 (GRCm38) nonsense probably null
R0704:Urb1 UTSW 16 90,776,207 (GRCm38) missense probably benign 0.31
R0755:Urb1 UTSW 16 90,779,138 (GRCm38) missense probably benign
R0755:Urb1 UTSW 16 90,774,094 (GRCm38) missense probably damaging 1.00
R0783:Urb1 UTSW 16 90,810,297 (GRCm38) missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90,795,448 (GRCm38) missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90,795,448 (GRCm38) missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90,769,447 (GRCm38) missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90,776,318 (GRCm38) splice site probably null
R1344:Urb1 UTSW 16 90,769,466 (GRCm38) missense probably damaging 1.00
R1418:Urb1 UTSW 16 90,769,466 (GRCm38) missense probably damaging 1.00
R1453:Urb1 UTSW 16 90,796,492 (GRCm38) missense probably damaging 1.00
R1470:Urb1 UTSW 16 90,752,014 (GRCm38) missense probably benign 0.34
R1470:Urb1 UTSW 16 90,752,014 (GRCm38) missense probably benign 0.34
R1520:Urb1 UTSW 16 90,774,745 (GRCm38) missense probably benign 0.00
R1521:Urb1 UTSW 16 90,753,863 (GRCm38) missense probably damaging 1.00
R1598:Urb1 UTSW 16 90,777,440 (GRCm38) missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90,760,452 (GRCm38) missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90,774,048 (GRCm38) critical splice donor site probably null
R1640:Urb1 UTSW 16 90,772,626 (GRCm38) missense probably benign 0.00
R1664:Urb1 UTSW 16 90,788,082 (GRCm38) critical splice donor site probably null
R1672:Urb1 UTSW 16 90,787,397 (GRCm38) missense probably damaging 1.00
R1694:Urb1 UTSW 16 90,767,040 (GRCm38) missense probably benign
R1856:Urb1 UTSW 16 90,761,695 (GRCm38) missense probably benign 0.00
R2001:Urb1 UTSW 16 90,762,344 (GRCm38) missense probably benign 0.30
R2196:Urb1 UTSW 16 90,774,256 (GRCm38) missense probably benign 0.01
R2850:Urb1 UTSW 16 90,774,256 (GRCm38) missense probably benign 0.01
R3009:Urb1 UTSW 16 90,774,798 (GRCm38) missense probably benign 0.09
R3104:Urb1 UTSW 16 90,795,443 (GRCm38) missense probably damaging 1.00
R3105:Urb1 UTSW 16 90,795,443 (GRCm38) missense probably damaging 1.00
R3106:Urb1 UTSW 16 90,795,443 (GRCm38) missense probably damaging 1.00
R3160:Urb1 UTSW 16 90,797,903 (GRCm38) missense probably damaging 1.00
R3162:Urb1 UTSW 16 90,797,903 (GRCm38) missense probably damaging 1.00
R3900:Urb1 UTSW 16 90,783,376 (GRCm38) missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90,769,465 (GRCm38) missense probably damaging 1.00
R4036:Urb1 UTSW 16 90,788,086 (GRCm38) missense probably benign
R4332:Urb1 UTSW 16 90,774,537 (GRCm38) missense probably damaging 1.00
R4448:Urb1 UTSW 16 90,769,394 (GRCm38) missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90,788,146 (GRCm38) missense probably benign 0.04
R4593:Urb1 UTSW 16 90,787,444 (GRCm38) missense probably damaging 1.00
R4610:Urb1 UTSW 16 90,776,271 (GRCm38) missense probably benign 0.43
R4659:Urb1 UTSW 16 90,776,129 (GRCm38) missense probably damaging 0.96
R4672:Urb1 UTSW 16 90,772,634 (GRCm38) missense probably benign
R4681:Urb1 UTSW 16 90,804,537 (GRCm38) missense probably damaging 0.99
R4771:Urb1 UTSW 16 90,753,518 (GRCm38) missense probably benign 0.00
R4790:Urb1 UTSW 16 90,769,555 (GRCm38) nonsense probably null
R4798:Urb1 UTSW 16 90,757,827 (GRCm38) missense probably benign 0.12
R4809:Urb1 UTSW 16 90,759,842 (GRCm38) missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90,795,414 (GRCm38) nonsense probably null
R4916:Urb1 UTSW 16 90,783,328 (GRCm38) missense probably damaging 1.00
R4969:Urb1 UTSW 16 90,805,411 (GRCm38) missense probably damaging 1.00
R5032:Urb1 UTSW 16 90,756,171 (GRCm38) missense probably benign 0.00
R5111:Urb1 UTSW 16 90,752,017 (GRCm38) missense probably benign 0.00
R5122:Urb1 UTSW 16 90,752,095 (GRCm38) nonsense probably null
R5184:Urb1 UTSW 16 90,783,274 (GRCm38) critical splice donor site probably null
R5199:Urb1 UTSW 16 90,792,748 (GRCm38) missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90,792,762 (GRCm38) missense probably damaging 1.00
R5767:Urb1 UTSW 16 90,776,163 (GRCm38) missense probably benign 0.00
R5812:Urb1 UTSW 16 90,804,537 (GRCm38) missense probably damaging 0.99
R5872:Urb1 UTSW 16 90,772,764 (GRCm38) nonsense probably null
R6052:Urb1 UTSW 16 90,762,383 (GRCm38) missense probably damaging 1.00
R6063:Urb1 UTSW 16 90,789,097 (GRCm38) missense probably benign 0.02
R6065:Urb1 UTSW 16 90,803,332 (GRCm38) missense probably benign 0.03
R6181:Urb1 UTSW 16 90,779,094 (GRCm38) missense probably benign 0.00
R6268:Urb1 UTSW 16 90,753,919 (GRCm38) missense probably benign 0.03
R6429:Urb1 UTSW 16 90,762,430 (GRCm38) splice site probably null
R6572:Urb1 UTSW 16 90,787,414 (GRCm38) missense probably benign 0.37
R6606:Urb1 UTSW 16 90,810,268 (GRCm38) missense probably benign 0.00
R6730:Urb1 UTSW 16 90,779,083 (GRCm38) missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90,782,106 (GRCm38) missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90,791,166 (GRCm38) missense probably damaging 1.00
R7238:Urb1 UTSW 16 90,752,115 (GRCm38) missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90,772,573 (GRCm38) critical splice donor site probably benign
R7341:Urb1 UTSW 16 90,772,573 (GRCm38) critical splice donor site probably benign
R7361:Urb1 UTSW 16 90,774,768 (GRCm38) missense probably damaging 0.99
R7365:Urb1 UTSW 16 90,772,573 (GRCm38) critical splice donor site probably benign
R7366:Urb1 UTSW 16 90,772,573 (GRCm38) critical splice donor site probably benign
R7440:Urb1 UTSW 16 90,787,408 (GRCm38) missense probably damaging 1.00
R7530:Urb1 UTSW 16 90,761,634 (GRCm38) missense probably damaging 1.00
R7553:Urb1 UTSW 16 90,792,864 (GRCm38) missense probably damaging 1.00
R7557:Urb1 UTSW 16 90,772,573 (GRCm38) critical splice donor site probably benign
R7603:Urb1 UTSW 16 90,772,573 (GRCm38) critical splice donor site probably benign
R7607:Urb1 UTSW 16 90,772,573 (GRCm38) critical splice donor site probably benign
R7609:Urb1 UTSW 16 90,772,573 (GRCm38) critical splice donor site probably benign
R7610:Urb1 UTSW 16 90,772,573 (GRCm38) critical splice donor site probably benign
R7612:Urb1 UTSW 16 90,797,910 (GRCm38) missense probably damaging 1.00
R7613:Urb1 UTSW 16 90,772,573 (GRCm38) critical splice donor site probably benign
R7684:Urb1 UTSW 16 90,786,118 (GRCm38) nonsense probably null
R8029:Urb1 UTSW 16 90,779,152 (GRCm38) missense possibly damaging 0.67
R8324:Urb1 UTSW 16 90,791,190 (GRCm38) missense probably damaging 1.00
R8680:Urb1 UTSW 16 90,774,625 (GRCm38) missense probably benign 0.00
R8785:Urb1 UTSW 16 90,803,423 (GRCm38) missense probably benign 0.07
R8914:Urb1 UTSW 16 90,810,234 (GRCm38) missense probably damaging 1.00
R8959:Urb1 UTSW 16 90,774,117 (GRCm38) missense probably benign 0.26
R9005:Urb1 UTSW 16 90,753,790 (GRCm38) missense probably benign 0.01
R9126:Urb1 UTSW 16 90,769,402 (GRCm38) missense possibly damaging 0.53
R9195:Urb1 UTSW 16 90,792,750 (GRCm38) missense probably benign 0.03
R9276:Urb1 UTSW 16 90,772,575 (GRCm38) splice site probably benign
R9534:Urb1 UTSW 16 90,786,208 (GRCm38) missense possibly damaging 0.54
Z1177:Urb1 UTSW 16 90,774,862 (GRCm38) missense probably benign 0.05
Z1177:Urb1 UTSW 16 90,753,883 (GRCm38) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTCCTCACGTAAGCAGAGGACAG -3'
(R):5'- GGCATCAGGTCAGTATCTCAGAAGC -3'

Sequencing Primer
(F):5'- AAGGTGAAGGCCCGACTC -3'
(R):5'- GGTCAGTATCTCAGAAGCAACCTC -3'
Posted On 2013-05-09