Mutagenetix > Incidental Mutations

Incidental Mutation 'R4594:Trappc8'

344300

Institutional Source

Beutler Lab

Gene Symbol

Trappc8

Ensembl Gene

ENSMUSG00000033382

Gene Name

trafficking protein particle complex 8

Synonyms

D030074E01Rik, Trs85, 5033403J15Rik

MMRRC Submission

041810-MU

Accession Numbers

Genbank: NM_029491; MGI: 2443008

Is this an essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R4594 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20817223-20896093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20836948 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 995 (V995E)

Ref Sequence

ENSEMBL: ENSMUSP00000153183 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025177] [ENSMUST00000225661]

Predicted Effect

probably benign
Transcript: ENSMUST00000025177
AA Change: V996E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000025177
Gene: ENSMUSG00000033382
AA Change: V996E

Domain	Start	End	E-Value	Type
Pfam:TRAPPC-Trs85	157	604	1e-167	PFAM
low complexity region	769	777	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225502

Predicted Effect

probably benign
Transcript: ENSMUST00000225661
AA Change: V995E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (66/66)

Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	A	G	5: 3,575,754	T64A	probably damaging	Het
4933427I04Rik	A	T	4: 123,860,538	T82S	possibly damaging	Het
Adamts15	A	T	9: 30,921,447	I264N	probably damaging	Het
Alpk1	G	A	3: 127,683,554	A285V	probably damaging	Het
Auh	T	C	13: 52,912,966		probably benign	Het
BC030499	T	A	11: 78,291,647	V94D	possibly damaging	Het
Cacna2d3	A	G	14: 28,982,346	F826S	probably benign	Het
Ccdc54	G	T	16: 50,590,017	Y295*	probably null	Het
Ctnna3	G	A	10: 64,586,079	V551I	probably benign	Het
Diaph3	C	T	14: 86,986,037	C347Y	probably damaging	Het
Dnajb5	A	G	4: 42,950,842		probably benign	Het
Dscam	A	T	16: 96,717,996	I847K	possibly damaging	Het
Fam8a1	T	C	13: 46,671,266	F243S	probably damaging	Het
Fat2	T	C	11: 55,284,752	I1712V	possibly damaging	Het
Fgfr1	T	C	8: 25,573,836	V793A	probably damaging	Het
Got2	T	C	8: 95,872,186	E196G	probably benign	Het
Gsk3b	G	A	16: 38,170,701	C107Y	possibly damaging	Het
H2-M5	T	C	17: 36,987,805	T250A	possibly damaging	Het
Il17f	T	A	1: 20,777,802	T151S	probably damaging	Het
Ints12	A	G	3: 133,108,868	N279D	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kynu	T	A	2: 43,679,890	S395T	probably benign	Het
Llgl1	C	T	11: 60,706,321	T226I	probably benign	Het
Mael	T	A	1: 166,235,487	Q132L	probably damaging	Het
Mcpt1	A	T	14: 56,018,652	R49S	probably benign	Het
Meioc	G	T	11: 102,674,166	G203C	probably damaging	Het
Mfsd4b1	A	G	10: 40,007,317	S46P	probably benign	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Mx2	C	A	16: 97,547,432	Y268*	probably null	Het
Myom1	A	G	17: 71,100,074	D1064G	possibly damaging	Het
Nek11	A	G	9: 105,392,847		probably null	Het
Nfe2	A	G	15: 103,248,805	L253S	probably damaging	Het
Nup205	T	C	6: 35,196,489	I478T	probably benign	Het
Nxpe2	T	C	9: 48,319,482	D529G	probably damaging	Het
Oard1	T	C	17: 48,415,239	S88P	possibly damaging	Het
Olfr1370	C	T	13: 21,072,522	V260I	probably benign	Het
Olfr231	G	T	1: 174,117,320	T232N	probably damaging	Het
Olfr639	T	C	7: 104,012,417	D95G	probably benign	Het
Olfr678	T	C	7: 105,069,590	V41A	probably benign	Het
Olfr732	G	A	14: 50,281,683	T190I	probably benign	Het
Olfr741	A	G	14: 50,486,162	R235G	probably benign	Het
Olfr906	A	C	9: 38,488,761	H244P	probably damaging	Het
Osgin1	C	T	8: 119,445,253	T262I	possibly damaging	Het
Plcb4	A	T	2: 136,002,599	M146L	probably damaging	Het
Prkdc	A	T	16: 15,767,966	E2456V	possibly damaging	Het
Ptk2	G	A	15: 73,206,196	A1004V	probably damaging	Het
Rab15	G	A	12: 76,800,671		probably benign	Het
Rad51ap2	T	C	12: 11,457,880	V601A	probably benign	Het
Rasef	T	A	4: 73,780,389	I12F	possibly damaging	Het
Rdh14	T	A	12: 10,394,567	N139K	probably damaging	Het
Rexo2	A	T	9: 48,480,417	V46E	probably damaging	Het
Slmap	A	T	14: 26,465,617	L68H	probably damaging	Het
Speer3	C	G	5: 13,796,380	A238G	possibly damaging	Het
Tmem132e	T	C	11: 82,435,068	I206T	possibly damaging	Het
Vmn2r12	A	C	5: 109,086,435	I637S	probably damaging	Het
Vmn2r124	T	C	17: 18,073,969	F773L	probably damaging	Het
Vmn2r99	A	T	17: 19,393,662	D548V	probably damaging	Het
Wdr81	T	C	11: 75,445,794	N1590D	probably benign	Het
Zbtb6	A	T	2: 37,429,042	N291K	possibly damaging	Het
Zfp119a	G	A	17: 55,866,325	R173C	probably benign	Het
Zmynd15	T	C	11: 70,464,182	L335P	probably damaging	Het

Other mutations in Trappc8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01077:Trappc8	APN	18	20836978	missense	probably benign	0.20
IGL01367:Trappc8	APN	18	20866119	missense	probably benign	0.01
IGL01537:Trappc8	APN	18	20835004	missense	probably benign
IGL01563:Trappc8	APN	18	20837046	missense	probably benign	0.00
IGL01982:Trappc8	APN	18	20874712	splice site	probably benign
IGL02709:Trappc8	APN	18	20837178	missense	possibly damaging	0.94
IGL03126:Trappc8	APN	18	20863595	missense	probably damaging	1.00
IGL03290:Trappc8	APN	18	20820935	missense	probably damaging	1.00
IGL03348:Trappc8	APN	18	20852781	missense	probably damaging	1.00
hoppa	UTSW	18	20836900	missense	probably benign	0.05
Lagomorpha	UTSW	18	20818190	missense	probably benign	0.11
rabbit	UTSW	18	20874680	missense	probably damaging	1.00
E7848:Trappc8	UTSW	18	20850918	missense	probably damaging	0.99
R0483:Trappc8	UTSW	18	20845601	missense	possibly damaging	0.60
R0492:Trappc8	UTSW	18	20866186	missense	probably benign	0.07
R0506:Trappc8	UTSW	18	20844188	missense	possibly damaging	0.49
R0610:Trappc8	UTSW	18	20837188	missense	probably damaging	1.00
R0892:Trappc8	UTSW	18	20831608	critical splice donor site	probably null
R1561:Trappc8	UTSW	18	20841623	nonsense	probably null
R1589:Trappc8	UTSW	18	20863551	missense	probably damaging	1.00
R1700:Trappc8	UTSW	18	20832998	missense	probably damaging	1.00
R1785:Trappc8	UTSW	18	20834940	splice site	probably null
R1786:Trappc8	UTSW	18	20834940	splice site	probably null
R1989:Trappc8	UTSW	18	20845651	missense	probably benign	0.04
R2181:Trappc8	UTSW	18	20819222	critical splice donor site	probably null
R2294:Trappc8	UTSW	18	20866154	nonsense	probably null
R4551:Trappc8	UTSW	18	20874672	missense	probably benign	0.10
R4631:Trappc8	UTSW	18	20867808	missense	probably benign	0.22
R4734:Trappc8	UTSW	18	20841572	nonsense	probably null
R4834:Trappc8	UTSW	18	20825065	missense	probably damaging	0.99
R5114:Trappc8	UTSW	18	20844180	missense	probably benign	0.04
R5262:Trappc8	UTSW	18	20818190	missense	probably benign	0.11
R5384:Trappc8	UTSW	18	20833062	splice site	probably null
R5476:Trappc8	UTSW	18	20865108	missense	probably damaging	1.00
R5503:Trappc8	UTSW	18	20836900	missense	probably benign	0.05
R5577:Trappc8	UTSW	18	20836779	nonsense	probably null
R5809:Trappc8	UTSW	18	20818082	missense	probably benign	0.08
R5825:Trappc8	UTSW	18	20873920	missense	probably damaging	1.00
R5886:Trappc8	UTSW	18	20874680	missense	probably damaging	1.00
R5936:Trappc8	UTSW	18	20874688	missense	probably damaging	1.00
R6024:Trappc8	UTSW	18	20833009	missense	probably damaging	0.98
R6105:Trappc8	UTSW	18	20846447	critical splice donor site	probably null
R6229:Trappc8	UTSW	18	20870745	missense	probably benign	0.00
R6376:Trappc8	UTSW	18	20837075	missense	probably benign	0.07
R6403:Trappc8	UTSW	18	20866071	missense	probably benign
R6459:Trappc8	UTSW	18	20836868	missense	probably benign	0.40
R6673:Trappc8	UTSW	18	20885257	missense	probably benign	0.01
R7041:Trappc8	UTSW	18	20874672	missense	probably benign	0.10
R7276:Trappc8	UTSW	18	20818091	missense	probably damaging	0.99
R7341:Trappc8	UTSW	18	20852647	missense	probably damaging	1.00
R7684:Trappc8	UTSW	18	20863502	missense	probably benign	0.01
R7702:Trappc8	UTSW	18	20825062	missense	probably damaging	0.99
R8210:Trappc8	UTSW	18	20873881	critical splice donor site	probably null
X0065:Trappc8	UTSW	18	20860522	missense	probably benign	0.03
Z1177:Trappc8	UTSW	18	20831663	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCTAGAAATGTTGGGCTTCATATTC -3'
(R):5'- AATGTCAGCAAATGTCCTCTGAC -3'

Sequencing Primer
(F):5'- GACATCATTCATAATTCGGAAGATGG -3'
(R):5'- CCTCTGACTGGACTGAAAGTTG -3'

Posted On

2015-09-25