Incidental Mutation 'R4595:Madd'
ID 344305
Institutional Source Beutler Lab
Gene Symbol Madd
Ensembl Gene ENSMUSG00000040687
Gene Name MAP-kinase activating death domain
Synonyms Rab3 GEP, 9630059K23Rik
MMRRC Submission 041811-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4595 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 90967705-91013404 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90998009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 673 (D673G)
Ref Sequence ENSEMBL: ENSMUSP00000107006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000099725] [ENSMUST00000111369] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111373] [ENSMUST00000111375] [ENSMUST00000111376] [ENSMUST00000111381] [ENSMUST00000140600]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000066420
AA Change: D673G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066473
AA Change: D673G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075269
AA Change: D673G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 1276 1290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077941
AA Change: D673G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1354 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099723
AA Change: D673G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1353 1367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099725
AA Change: D673G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000097313
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111369
AA Change: D673G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107000
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111370
AA Change: D673G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111371
AA Change: D673G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 909 919 N/A INTRINSIC
low complexity region 1296 1310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111372
AA Change: D673G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1295 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111373
AA Change: D673G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107004
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 2.9e-29 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 8.7e-71 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 2.8e-16 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111375
AA Change: D673G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107006
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 773 796 N/A INTRINSIC
low complexity region 885 895 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111376
AA Change: D673G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1312 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111381
AA Change: D673G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687
AA Change: D673G

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1315 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130395
Predicted Effect probably benign
Transcript: ENSMUST00000140600
SMART Domains Protein: ENSMUSP00000117657
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
Blast:DENN 1 28 7e-10 BLAST
low complexity region 39 55 N/A INTRINSIC
dDENN 111 165 9.37e-1 SMART
low complexity region 230 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154028
Meta Mutation Damage Score 0.0890 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor alpha (TNF-alpha) is a signaling molecule that interacts with one of two receptors on cells targeted for apoptosis. The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a death domain-containing adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK) and propagate the apoptotic signal. It is membrane-bound and expressed at a higher level in neoplastic cells than in normal cells. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth due to respiratory failure, are hyporesponsive to tactile stimuli, and exhibit defects in neurotransmitter release with impaired synaptic vesicle trafficking and depletion of synaptic vesicles at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
4921536K21Rik A G 11: 3,840,052 (GRCm39) I115T probably benign Het
Acads A T 5: 115,251,123 (GRCm39) N120K probably damaging Het
Aco1 T A 4: 40,167,139 (GRCm39) C118S probably benign Het
Alpk2 T C 18: 65,422,819 (GRCm39) T1493A probably damaging Het
AU018091 A G 7: 3,208,268 (GRCm39) Y480H possibly damaging Het
Brd4 A T 17: 32,417,896 (GRCm39) I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 (GRCm39) E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 (GRCm39) N368S probably benign Het
Cenpp A T 13: 49,794,710 (GRCm39) F152L probably benign Het
Cfap46 T A 7: 139,232,320 (GRCm39) D881V possibly damaging Het
Chmp7 A G 14: 69,958,678 (GRCm39) V212A probably damaging Het
Col9a2 A T 4: 120,902,352 (GRCm39) K196N probably benign Het
Copg2 T C 6: 30,749,449 (GRCm39) D814G probably damaging Het
Dcaf13 G A 15: 38,982,288 (GRCm39) G85R probably damaging Het
Dnah9 A G 11: 66,058,978 (GRCm39) S106P probably benign Het
Dpp8 A G 9: 64,983,085 (GRCm39) D739G probably damaging Het
Drd2 T A 9: 49,316,089 (GRCm39) M283K probably benign Het
Espl1 A G 15: 102,207,159 (GRCm39) T208A probably benign Het
Glul G A 1: 153,778,796 (GRCm39) G35D possibly damaging Het
Gm14412 T C 2: 177,007,005 (GRCm39) K297E unknown Het
Gm21976 A T 13: 98,442,318 (GRCm39) R120W probably damaging Het
Hipk3 T A 2: 104,271,622 (GRCm39) T437S probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Lipn T G 19: 34,058,750 (GRCm39) Y321D probably damaging Het
Lrwd1 A G 5: 136,152,810 (GRCm39) V484A probably benign Het
Marveld1 T A 19: 42,136,203 (GRCm39) L39Q probably damaging Het
Mfsd2b T C 12: 4,915,807 (GRCm39) T299A possibly damaging Het
Micu3 T C 8: 40,812,438 (GRCm39) probably benign Het
Mmp7 T C 9: 7,697,667 (GRCm39) V234A probably damaging Het
Nhsl1 T A 10: 18,403,357 (GRCm39) D1329E probably benign Het
Or4a15 C T 2: 89,193,669 (GRCm39) V35M probably damaging Het
Or4f14b T C 2: 111,774,997 (GRCm39) D268G possibly damaging Het
Or52a33 A G 7: 103,289,308 (GRCm39) F13S probably damaging Het
Pcdhb21 T A 18: 37,647,568 (GRCm39) D232E probably damaging Het
Pebp1 G T 5: 117,421,475 (GRCm39) D156E probably benign Het
Pik3cb A G 9: 98,937,459 (GRCm39) Y745H possibly damaging Het
Pld2 T C 11: 70,432,846 (GRCm39) L170P probably damaging Het
Ptch1 T C 13: 63,691,422 (GRCm39) D277G possibly damaging Het
Rab11fip1 A T 8: 27,644,603 (GRCm39) M394K probably damaging Het
Rhoq T C 17: 87,271,754 (GRCm39) Y57H probably benign Het
Setbp1 T C 18: 78,900,731 (GRCm39) I979V probably benign Het
Slc6a4 A G 11: 76,910,689 (GRCm39) I447V probably benign Het
Sos2 T C 12: 69,663,663 (GRCm39) K607R probably damaging Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Syne2 A T 12: 76,013,845 (GRCm39) Q3012L possibly damaging Het
Taf1b T A 12: 24,550,441 (GRCm39) F9I possibly damaging Het
Tex35 T A 1: 156,926,909 (GRCm39) Y195F probably benign Het
Tnc T C 4: 63,913,982 (GRCm39) T1277A probably damaging Het
Tnfsf15 G T 4: 63,648,180 (GRCm39) Y153* probably null Het
Trim5 C A 7: 103,914,639 (GRCm39) V477F probably damaging Het
Trp73 A G 4: 154,148,874 (GRCm39) I245T probably damaging Het
Zbtb16 C T 9: 48,743,380 (GRCm39) E311K possibly damaging Het
Zmynd19 A G 2: 24,849,000 (GRCm39) D165G probably damaging Het
Other mutations in Madd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Madd APN 2 91,006,111 (GRCm39) unclassified probably benign
IGL00781:Madd APN 2 90,977,273 (GRCm39) missense probably benign 0.00
IGL00844:Madd APN 2 90,998,213 (GRCm39) missense probably damaging 1.00
IGL00942:Madd APN 2 91,000,923 (GRCm39) missense probably damaging 1.00
IGL01100:Madd APN 2 90,988,385 (GRCm39) missense probably damaging 1.00
IGL01116:Madd APN 2 90,984,888 (GRCm39) splice site probably benign
IGL01694:Madd APN 2 90,988,320 (GRCm39) splice site probably benign
IGL01982:Madd APN 2 91,006,052 (GRCm39) missense probably damaging 1.00
IGL02346:Madd APN 2 90,992,836 (GRCm39) missense probably damaging 0.97
IGL02354:Madd APN 2 90,992,543 (GRCm39) missense probably benign 0.17
IGL02361:Madd APN 2 90,992,543 (GRCm39) missense probably benign 0.17
IGL02481:Madd APN 2 91,008,381 (GRCm39) missense probably damaging 1.00
IGL02483:Madd APN 2 91,008,381 (GRCm39) missense probably damaging 1.00
IGL02948:Madd APN 2 90,973,172 (GRCm39) missense probably benign
IGL03338:Madd APN 2 90,992,507 (GRCm39) missense possibly damaging 0.48
BB005:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
BB015:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
R0026:Madd UTSW 2 91,006,053 (GRCm39) missense possibly damaging 0.88
R0026:Madd UTSW 2 91,006,053 (GRCm39) missense possibly damaging 0.88
R0027:Madd UTSW 2 90,982,894 (GRCm39) missense probably damaging 0.97
R0085:Madd UTSW 2 90,993,083 (GRCm39) missense probably benign 0.00
R0577:Madd UTSW 2 90,968,740 (GRCm39) missense possibly damaging 0.88
R0587:Madd UTSW 2 90,977,230 (GRCm39) missense probably damaging 1.00
R1112:Madd UTSW 2 90,973,944 (GRCm39) missense probably damaging 1.00
R1722:Madd UTSW 2 90,997,982 (GRCm39) missense probably benign
R1750:Madd UTSW 2 90,998,236 (GRCm39) missense probably damaging 0.98
R2061:Madd UTSW 2 90,991,831 (GRCm39) intron probably benign
R2112:Madd UTSW 2 91,007,321 (GRCm39) missense possibly damaging 0.89
R2114:Madd UTSW 2 90,994,367 (GRCm39) missense probably damaging 1.00
R2140:Madd UTSW 2 90,982,854 (GRCm39) missense possibly damaging 0.80
R2276:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2277:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2279:Madd UTSW 2 90,974,028 (GRCm39) missense possibly damaging 0.67
R2424:Madd UTSW 2 90,996,967 (GRCm39) missense probably damaging 1.00
R2904:Madd UTSW 2 91,006,017 (GRCm39) missense probably damaging 1.00
R3122:Madd UTSW 2 91,006,554 (GRCm39) missense probably damaging 1.00
R3836:Madd UTSW 2 90,984,988 (GRCm39) critical splice donor site probably null
R3979:Madd UTSW 2 91,007,173 (GRCm39) missense possibly damaging 0.81
R4151:Madd UTSW 2 90,973,428 (GRCm39) missense probably benign 0.11
R4233:Madd UTSW 2 91,008,581 (GRCm39) missense probably benign 0.26
R4236:Madd UTSW 2 90,997,373 (GRCm39) missense probably benign 0.00
R4299:Madd UTSW 2 91,000,148 (GRCm39) missense probably damaging 1.00
R4334:Madd UTSW 2 90,970,917 (GRCm39) missense probably benign 0.08
R4413:Madd UTSW 2 90,997,932 (GRCm39) missense probably damaging 1.00
R4694:Madd UTSW 2 90,990,673 (GRCm39) missense probably damaging 0.99
R5410:Madd UTSW 2 90,984,859 (GRCm39) missense probably damaging 1.00
R5490:Madd UTSW 2 91,000,980 (GRCm39) missense possibly damaging 0.80
R5560:Madd UTSW 2 90,993,890 (GRCm39) missense probably damaging 1.00
R5661:Madd UTSW 2 90,984,778 (GRCm39) critical splice donor site probably null
R5710:Madd UTSW 2 90,984,821 (GRCm39) missense probably damaging 1.00
R5730:Madd UTSW 2 90,988,454 (GRCm39) missense probably damaging 1.00
R5759:Madd UTSW 2 90,992,420 (GRCm39) missense possibly damaging 0.94
R5768:Madd UTSW 2 90,998,174 (GRCm39) missense probably damaging 1.00
R5822:Madd UTSW 2 90,982,878 (GRCm39) missense probably damaging 1.00
R6125:Madd UTSW 2 90,982,797 (GRCm39) critical splice donor site probably null
R6151:Madd UTSW 2 90,995,802 (GRCm39) nonsense probably null
R6229:Madd UTSW 2 90,974,015 (GRCm39) missense probably damaging 0.96
R6230:Madd UTSW 2 90,973,866 (GRCm39) critical splice donor site probably null
R6245:Madd UTSW 2 91,008,449 (GRCm39) missense probably benign 0.27
R6323:Madd UTSW 2 90,991,783 (GRCm39) splice site probably null
R6456:Madd UTSW 2 91,008,536 (GRCm39) missense probably benign
R6473:Madd UTSW 2 90,997,404 (GRCm39) missense probably benign
R6878:Madd UTSW 2 91,000,202 (GRCm39) missense probably damaging 1.00
R7060:Madd UTSW 2 91,007,452 (GRCm39) missense probably damaging 1.00
R7065:Madd UTSW 2 90,985,402 (GRCm39) missense probably benign 0.26
R7073:Madd UTSW 2 90,992,854 (GRCm39) missense probably damaging 1.00
R7124:Madd UTSW 2 90,992,393 (GRCm39) missense possibly damaging 0.94
R7251:Madd UTSW 2 90,992,521 (GRCm39) missense probably benign 0.01
R7510:Madd UTSW 2 91,008,321 (GRCm39) missense possibly damaging 0.80
R7605:Madd UTSW 2 91,000,055 (GRCm39) missense possibly damaging 0.90
R7911:Madd UTSW 2 90,997,853 (GRCm39) missense probably null 0.01
R7928:Madd UTSW 2 91,007,233 (GRCm39) missense probably damaging 1.00
R7952:Madd UTSW 2 90,992,886 (GRCm39) missense probably damaging 1.00
R8039:Madd UTSW 2 90,997,406 (GRCm39) missense probably benign 0.17
R8047:Madd UTSW 2 91,009,546 (GRCm39) missense probably damaging 1.00
R8048:Madd UTSW 2 90,984,793 (GRCm39) missense probably damaging 0.99
R8070:Madd UTSW 2 90,988,359 (GRCm39) nonsense probably null
R8090:Madd UTSW 2 90,985,968 (GRCm39) missense probably benign 0.01
R8335:Madd UTSW 2 91,000,584 (GRCm39) missense probably damaging 1.00
R8459:Madd UTSW 2 90,992,871 (GRCm39) missense probably benign
R8678:Madd UTSW 2 91,006,610 (GRCm39) missense probably damaging 1.00
R8920:Madd UTSW 2 91,007,168 (GRCm39) missense probably benign 0.04
R9003:Madd UTSW 2 90,988,359 (GRCm39) nonsense probably null
R9102:Madd UTSW 2 90,988,404 (GRCm39) missense probably benign 0.00
R9154:Madd UTSW 2 90,998,162 (GRCm39) missense probably damaging 1.00
R9242:Madd UTSW 2 90,973,949 (GRCm39) missense probably damaging 0.99
R9277:Madd UTSW 2 91,006,055 (GRCm39) missense probably damaging 1.00
R9394:Madd UTSW 2 91,000,199 (GRCm39) missense probably benign
R9490:Madd UTSW 2 91,008,501 (GRCm39) missense probably benign
R9499:Madd UTSW 2 91,000,434 (GRCm39) missense probably damaging 1.00
R9551:Madd UTSW 2 91,000,434 (GRCm39) missense probably damaging 1.00
R9553:Madd UTSW 2 91,008,800 (GRCm39) missense probably damaging 1.00
R9599:Madd UTSW 2 91,006,026 (GRCm39) missense probably damaging 1.00
R9695:Madd UTSW 2 90,992,929 (GRCm39) missense probably benign 0.17
R9729:Madd UTSW 2 91,000,544 (GRCm39) missense possibly damaging 0.60
X0067:Madd UTSW 2 90,982,818 (GRCm39) missense probably damaging 1.00
Z1176:Madd UTSW 2 90,989,617 (GRCm39) missense probably damaging 0.96
Z1177:Madd UTSW 2 90,973,176 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAACAGTTTAGGCCCACATCC -3'
(R):5'- TCCCTTGGGGACTTTGTCAG -3'

Sequencing Primer
(F):5'- TCCTAAACAGTGGCTGTCAC -3'
(R):5'- TGTCAGTGAAATGATGAAATGTGAC -3'
Posted On 2015-09-25