Incidental Mutation 'R4595:Trp73'
ID 344315
Institutional Source Beutler Lab
Gene Symbol Trp73
Ensembl Gene ENSMUSG00000029026
Gene Name transformation related protein 73
Synonyms deltaNp73, TAp73, p73
MMRRC Submission 041811-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.665) question?
Stock # R4595 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 154140706-154224332 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 154148874 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 245 (I245T)
Ref Sequence ENSEMBL: ENSMUSP00000095368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097762] [ENSMUST00000097763] [ENSMUST00000105643] [ENSMUST00000105644] [ENSMUST00000133533] [ENSMUST00000139634] [ENSMUST00000155642]
AlphaFold Q9JJP2
Predicted Effect probably damaging
Transcript: ENSMUST00000097762
AA Change: I245T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095368
Gene: ENSMUSG00000029026
AA Change: I245T

DomainStartEndE-ValueType
Pfam:P53 64 260 2.6e-111 PFAM
Pfam:P53_tetramer 296 337 8.5e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Pfam:SAM_2 352 406 1.3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097763
AA Change: I245T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134196
Gene: ENSMUSG00000029026
AA Change: I245T

DomainStartEndE-ValueType
Pfam:P53 64 260 6.4e-112 PFAM
Pfam:P53_tetramer 296 337 2.3e-21 PFAM
low complexity region 341 362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105643
AA Change: I245T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101268
Gene: ENSMUSG00000029026
AA Change: I245T

DomainStartEndE-ValueType
Pfam:P53 64 260 2.1e-111 PFAM
Pfam:P53_tetramer 296 337 7.6e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105644
AA Change: I293T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101269
Gene: ENSMUSG00000029026
AA Change: I293T

DomainStartEndE-ValueType
Pfam:P53 112 308 3.1e-115 PFAM
Pfam:P53_tetramer 344 383 8.3e-21 PFAM
low complexity region 390 398 N/A INTRINSIC
SAM 486 552 2.71e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133533
AA Change: I245T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114418
Gene: ENSMUSG00000029026
AA Change: I245T

DomainStartEndE-ValueType
Pfam:P53 64 260 3.8e-111 PFAM
Pfam:P53_tetramer 296 337 1.1e-20 PFAM
low complexity region 342 350 N/A INTRINSIC
SAM 438 504 2.71e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139634
SMART Domains Protein: ENSMUSP00000114736
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:P53 152 204 3.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155642
SMART Domains Protein: ENSMUSP00000135281
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 42 213 1.3e-94 PFAM
Meta Mutation Damage Score 0.9445 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 94% (62/66)
MGI Phenotype FUNCTION: This gene encodes tumor protein p73, which is a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include p53, p63, and p73 and have high sequence similarity to one another, which allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways involving direct or indirect protein interactions, resulting in regulation of the same target gene promoters or regulation of each other's promoters. The p73 protein is expressed at very low levels in normal tissues and is differentially expressed in a number of tumors. The p73 gene expresses at least 35 mRNA variants due to the use of alternate promoters, alternate translation initiation sites, and multiple splice variations. Theoretically this can account for 29 different p73 isoforms; however, the biological validity and the full-length nature of most variants have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display a variety of defects including hippocampal dysgenesis, hydrocephalus, chronic infections and inflammation, abnormal pheromone sensory pathways, eye abnormalities, impaired growth, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
4921536K21Rik A G 11: 3,840,052 (GRCm39) I115T probably benign Het
Acads A T 5: 115,251,123 (GRCm39) N120K probably damaging Het
Aco1 T A 4: 40,167,139 (GRCm39) C118S probably benign Het
Alpk2 T C 18: 65,422,819 (GRCm39) T1493A probably damaging Het
AU018091 A G 7: 3,208,268 (GRCm39) Y480H possibly damaging Het
Brd4 A T 17: 32,417,896 (GRCm39) I86N probably damaging Het
Ccdc180 A G 4: 45,945,023 (GRCm39) E1477G probably damaging Het
Ccne2 A G 4: 11,202,986 (GRCm39) N368S probably benign Het
Cenpp A T 13: 49,794,710 (GRCm39) F152L probably benign Het
Cfap46 T A 7: 139,232,320 (GRCm39) D881V possibly damaging Het
Chmp7 A G 14: 69,958,678 (GRCm39) V212A probably damaging Het
Col9a2 A T 4: 120,902,352 (GRCm39) K196N probably benign Het
Copg2 T C 6: 30,749,449 (GRCm39) D814G probably damaging Het
Dcaf13 G A 15: 38,982,288 (GRCm39) G85R probably damaging Het
Dnah9 A G 11: 66,058,978 (GRCm39) S106P probably benign Het
Dpp8 A G 9: 64,983,085 (GRCm39) D739G probably damaging Het
Drd2 T A 9: 49,316,089 (GRCm39) M283K probably benign Het
Espl1 A G 15: 102,207,159 (GRCm39) T208A probably benign Het
Glul G A 1: 153,778,796 (GRCm39) G35D possibly damaging Het
Gm14412 T C 2: 177,007,005 (GRCm39) K297E unknown Het
Gm21976 A T 13: 98,442,318 (GRCm39) R120W probably damaging Het
Hipk3 T A 2: 104,271,622 (GRCm39) T437S probably benign Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Lipn T G 19: 34,058,750 (GRCm39) Y321D probably damaging Het
Lrwd1 A G 5: 136,152,810 (GRCm39) V484A probably benign Het
Madd T C 2: 90,998,009 (GRCm39) D673G possibly damaging Het
Marveld1 T A 19: 42,136,203 (GRCm39) L39Q probably damaging Het
Mfsd2b T C 12: 4,915,807 (GRCm39) T299A possibly damaging Het
Micu3 T C 8: 40,812,438 (GRCm39) probably benign Het
Mmp7 T C 9: 7,697,667 (GRCm39) V234A probably damaging Het
Nhsl1 T A 10: 18,403,357 (GRCm39) D1329E probably benign Het
Or4a15 C T 2: 89,193,669 (GRCm39) V35M probably damaging Het
Or4f14b T C 2: 111,774,997 (GRCm39) D268G possibly damaging Het
Or52a33 A G 7: 103,289,308 (GRCm39) F13S probably damaging Het
Pcdhb21 T A 18: 37,647,568 (GRCm39) D232E probably damaging Het
Pebp1 G T 5: 117,421,475 (GRCm39) D156E probably benign Het
Pik3cb A G 9: 98,937,459 (GRCm39) Y745H possibly damaging Het
Pld2 T C 11: 70,432,846 (GRCm39) L170P probably damaging Het
Ptch1 T C 13: 63,691,422 (GRCm39) D277G possibly damaging Het
Rab11fip1 A T 8: 27,644,603 (GRCm39) M394K probably damaging Het
Rhoq T C 17: 87,271,754 (GRCm39) Y57H probably benign Het
Setbp1 T C 18: 78,900,731 (GRCm39) I979V probably benign Het
Slc6a4 A G 11: 76,910,689 (GRCm39) I447V probably benign Het
Sos2 T C 12: 69,663,663 (GRCm39) K607R probably damaging Het
Stt3a T C 9: 36,646,808 (GRCm39) I602V probably damaging Het
Syne2 A T 12: 76,013,845 (GRCm39) Q3012L possibly damaging Het
Taf1b T A 12: 24,550,441 (GRCm39) F9I possibly damaging Het
Tex35 T A 1: 156,926,909 (GRCm39) Y195F probably benign Het
Tnc T C 4: 63,913,982 (GRCm39) T1277A probably damaging Het
Tnfsf15 G T 4: 63,648,180 (GRCm39) Y153* probably null Het
Trim5 C A 7: 103,914,639 (GRCm39) V477F probably damaging Het
Zbtb16 C T 9: 48,743,380 (GRCm39) E311K possibly damaging Het
Zmynd19 A G 2: 24,849,000 (GRCm39) D165G probably damaging Het
Other mutations in Trp73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Trp73 APN 4 154,165,943 (GRCm39) missense possibly damaging 0.82
IGL02264:Trp73 APN 4 154,148,885 (GRCm39) missense probably null 0.98
IGL02344:Trp73 APN 4 154,146,500 (GRCm39) missense possibly damaging 0.92
IGL02663:Trp73 APN 4 154,146,963 (GRCm39) splice site probably null
IGL02956:Trp73 APN 4 154,148,920 (GRCm39) splice site probably benign
IGL03093:Trp73 APN 4 154,189,330 (GRCm39) missense probably benign 0.00
slowpoke UTSW 4 154,149,089 (GRCm39) splice site probably null
R0238:Trp73 UTSW 4 154,146,981 (GRCm39) unclassified probably benign
R0238:Trp73 UTSW 4 154,146,981 (GRCm39) unclassified probably benign
R0363:Trp73 UTSW 4 154,148,406 (GRCm39) missense probably benign 0.17
R0409:Trp73 UTSW 4 154,148,841 (GRCm39) missense possibly damaging 0.81
R1161:Trp73 UTSW 4 154,165,780 (GRCm39) splice site probably null
R1531:Trp73 UTSW 4 154,148,352 (GRCm39) missense probably benign 0.31
R2002:Trp73 UTSW 4 154,165,902 (GRCm39) missense probably damaging 1.00
R2185:Trp73 UTSW 4 154,189,274 (GRCm39) critical splice donor site probably null
R3965:Trp73 UTSW 4 154,146,493 (GRCm39) missense probably benign 0.03
R3966:Trp73 UTSW 4 154,146,493 (GRCm39) missense probably benign 0.03
R4247:Trp73 UTSW 4 154,149,089 (GRCm39) splice site probably null
R5170:Trp73 UTSW 4 154,189,295 (GRCm39) missense possibly damaging 0.95
R5260:Trp73 UTSW 4 154,147,059 (GRCm39) missense possibly damaging 0.48
R5622:Trp73 UTSW 4 154,145,049 (GRCm39) missense possibly damaging 0.68
R6173:Trp73 UTSW 4 154,188,798 (GRCm39) missense probably damaging 1.00
R6252:Trp73 UTSW 4 154,148,854 (GRCm39) missense probably damaging 1.00
R6950:Trp73 UTSW 4 154,146,510 (GRCm39) missense probably benign 0.18
R7043:Trp73 UTSW 4 154,151,464 (GRCm39) splice site probably null
R7050:Trp73 UTSW 4 154,165,899 (GRCm39) missense probably damaging 1.00
R7052:Trp73 UTSW 4 154,149,140 (GRCm39) missense probably damaging 0.98
R7620:Trp73 UTSW 4 154,143,714 (GRCm39) nonsense probably null
R8086:Trp73 UTSW 4 154,201,052 (GRCm39) missense unknown
R9034:Trp73 UTSW 4 154,152,088 (GRCm39) missense probably benign 0.00
R9647:Trp73 UTSW 4 154,165,788 (GRCm39) missense probably damaging 1.00
R9671:Trp73 UTSW 4 154,148,403 (GRCm39) missense probably benign 0.03
R9746:Trp73 UTSW 4 154,165,859 (GRCm39) missense probably damaging 0.99
Z1176:Trp73 UTSW 4 154,151,469 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTTGGCACCTTTGGAG -3'
(R):5'- TGTCATCATCACCCTGGAGACC -3'

Sequencing Primer
(F):5'- CACCTTTGGAGCAGGTACTC -3'
(R):5'- AGACCCGGGAGTGAGTCTG -3'
Posted On 2015-09-25